Mutant Report for Mutant ID: 25859

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9635
Chromat Path: H:\Pa14\MrT7\270v1\270v1_C11_C11_086.ab1 Last Transposon Base: 58 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
ACGTTTGTATCGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTACGGCGACC
AGCGCAGCGTGGTGGGCAGCGTCAGCTACAAGTGGTGAGCGACGCGTCACAGGTGCGCAACGGCGGATAA
CCGCTTCGCGGTTATCCGCCCTACCGCAGAACGTACCTTCCGGGCACCGGATGCCCTCCTCCCGCCTGTG
GGAGAGGGCCGGGATATCGGTAGCCGGCGCATCGGGGAGGACCTGCATTCCGGGCGCCGGAGATCGTCGT
TCACCCCGCGATCCGACCCCACAGCGCGCTGGCGTCGTCGTGGATCTTGAAACGCGGGAAAGCCAGGGCC
TGGTCGTCGCCCTGTTCGATCTCGCGCAACTCGTCGAGCATGGCGCTCACTCCGACGTCCTCGAGGCGCC
GCAGCAACTGTTCGTCGGTATAGCGGCGGAAAGGCTCGACCAGCCGGTCGAAGCCGTCGGTCATCAGCAC
GAAGGAACGCAACGCGGCGAGCGGCAAGGTCTCGCGCTGCACCTGGCCGAGCCAGCGGTCGCTGATGTCC
AGCGCCCAGTAGCCCTCGGGCTTGTTCATCAGCAGGCGGTTCTGCCGCACGCGCGGGCGGCTGGCCTTGA
ACAGTTCGGCGTGATCCCACTGCGGATGTTCCTCGCGCATCCGGCAGAAATGCGCCAGGGATTGCCGGTC
CAGTTCATACAGGGCCGAATCTCTATGTGGGGTATCGTGACGTCGGCGCCTTCGACGAGATCCGGCTGTC
GCCGATGTTGAGCAGTTCGATTTCTCCGCCGCGCATCCTCTGCAGGCCAGCAAAGTGGGGGTGGGGACAT
TAAGGCTTGGCTATTCCGGCCGCCTATGGCGCCGAAT
Blast against PA14
Processed Seqquence ID: 5773
5' Trim Position: 10 3' Trim Position: 714
Processed Sequence:
(Transposon Sequence in Red)
CGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTACGGCGACCAGCGCAGCGT
GGTGGGCAGCGTCAGCTACAAGTGGTGAGCGACGCGTCACAGGTGCGCAACGGCGGATAACCGCTTCGCG
GTTATCCGCCCTACCGCAGAACGTACCTTCCGGGCACCGGATGCCCTCCTCCCGCCTGTGGGAGAGGGCC
GGGATATCGGTAGCCGGCGCATCGGGGAGGACCTGCATTCCGGGCGCCGGAGATCGTCGTTCACCCCGCG
ATCCGACCCCACAGCGCGCTGGCGTCGTCGTGGATCTTGAAACGCGGGAAAGCCAGGGCCTGGTCGTCGC
CCTGTTCGATCTCGCGCAACTCGTCGAGCATGGCGCTCACTCCGACGTCCTCGAGGCGCCGCAGCAACTG
TTCGTCGGTATAGCGGCGGAAAGGCTCGACCAGCCGGTCGAAGCCGTCGGTCATCAGCACGAAGGAACGC
AACGCGGCGAGCGGCAAGGTCTCGCGCTGCACCTGGCCGAGCCAGCGGTCGCTGATGTCCAGCGCCCAGT
AGCCCTCGGGCTTGTTCATCAGCAGGCGGTTCTGCCGCACGCGCGGGCGGCTGGCCTTGAACAGTTCGGC
GTGATCCCACTGCGGATGTTCCTCGCGCATCCGGCAGAAATGCGCCAGGGATTGCCGGTCCAGTTCATAC
AGGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
25485 25485 25486 25486 25487 25487 25488 25488 25489 25489 25490 25490 25491 25491 25492 25492 25493 25493 25494 25494 25495 25495 25496 25496 25497 25497 25498 25498 25499 25499 25500 25500 25501 25501 25502 25502 25503 25503 25504 25504 25505 25505 25506 25506 25507 25507 25508 25508 25509 25509 25510 25510 25511 25511 25512 25512 25513 25513 25514 25514 25515 25515 25516 25516 25517 25517 25518 25518 25519 25519 25520 25520 25521 25521 25522 25522 25523 25523 25524 25524 25525 25525 25526 25526 25527 25527 25528 25528 25529 25529 25530 25530 25531 25531 25532 25532 25533 25533 25534 25534 25535 25535 25536 25536 25537 25537
PA14 BLAST Hit ID: 25485       Show Transposon Map
Identities: 656/657 (99.84%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 93.18%
Query Start: 48 Query End: 704 Subject Start: 542893 Subject End: 542237 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 542893 PA14_06140*,PA14_06160 +,+
Raw Sequence Start: 542950 PA14_06160 +
Extrapolated Insert Location: 542892 PA14_06140*,PA14_06160 +,+
Default Offset Location: 542887 PA14_06140*,PA14_06160 +,+
PA14 BLAST Hit ID: 25486       Show Transposon Map
Identities: 34/36 (94.44%) BLAST Bit Score: 56.0 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 121 Query End: 156 Subject Start: 5765800 Subject End: 5765765 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5765800
Raw Sequence Start: 5765930 PA14_64720 +
Extrapolated Insert Location: 5765872 PA14_64720 +
Default Offset Location: 5765867 PA14_64720 +
PA14 BLAST Hit ID: 25487       Show Transposon Map
Identities: 35/38 (92.10%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 5.26%
Query Start: 121 Query End: 158 Subject Start: 4700721 Subject End: 4700758 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4700721
Raw Sequence Start: 4700591 PA14_53010 +
Extrapolated Insert Location: 4700649
Default Offset Location: 4700654
PA14 BLAST Hit ID: 25488       Show Transposon Map
Identities: 28/29 (96.55%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 6051871 Subject End: 6051899 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6051871 PA14_67760* -
Raw Sequence Start: 6051740 PA14_67770,PA14_67760* +,-
Extrapolated Insert Location: 6051798 PA14_67770,PA14_67760* +,-
Default Offset Location: 6051803 PA14_67770,PA14_67760* +,-
PA14 BLAST Hit ID: 25489       Show Transposon Map
Identities: 28/29 (96.55%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 1343387 Subject End: 1343415 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1343387
Raw Sequence Start: 1343256 PA14_15760* -
Extrapolated Insert Location: 1343314
Default Offset Location: 1343319
PA14 BLAST Hit ID: 25490       Show Transposon Map
Identities: 28/29 (96.55%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 827017 Subject End: 827045 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 827017 PA14_09620* +
Raw Sequence Start: 826886 PA14_09610 -
Extrapolated Insert Location: 826944
Default Offset Location: 826949
PA14 BLAST Hit ID: 25491       Show Transposon Map
Identities: 30/32 (93.75%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 4.40%
Query Start: 121 Query End: 152 Subject Start: 6051900 Subject End: 6051869 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6051900 PA14_67760* +
Raw Sequence Start: 6052030
Extrapolated Insert Location: 6051972 PA14_67760* +
Default Offset Location: 6051967 PA14_67760* +
PA14 BLAST Hit ID: 25492       Show Transposon Map
Identities: 33/36 (91.66%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 119 Query End: 154 Subject Start: 5021960 Subject End: 5021925 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5021960
Raw Sequence Start: 5022088 PA14_56250 +
Extrapolated Insert Location: 5022030
Default Offset Location: 5022025
PA14 BLAST Hit ID: 25493       Show Transposon Map
Identities: 27/28 (96.42%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 3.84%
Query Start: 122 Query End: 149 Subject Start: 3373475 Subject End: 3373502 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3373475
Raw Sequence Start: 3373344
Extrapolated Insert Location: 3373402
Default Offset Location: 3373407
PA14 BLAST Hit ID: 25494       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.69%
Query Start: 121 Query End: 154 Subject Start: 4130079 Subject End: 4130112 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4130079 PA14_46410* -
Raw Sequence Start: 4129949 PA14_46420,PA14_46410* +,-
Extrapolated Insert Location: 4130007 PA14_46420,PA14_46410* +,-
Default Offset Location: 4130012 PA14_46420,PA14_46410* +,-
PA14 BLAST Hit ID: 25495       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.69%
Query Start: 121 Query End: 154 Subject Start: 1697420 Subject End: 1697453 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1697420
Raw Sequence Start: 1697290 PA14_19660 +
Extrapolated Insert Location: 1697348 PA14_19660 +
Default Offset Location: 1697353 PA14_19660 +
PA14 BLAST Hit ID: 25496       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.69%
Query Start: 121 Query End: 154 Subject Start: 1343416 Subject End: 1343383 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1343416
Raw Sequence Start: 1343546 PA14_15780 +
Extrapolated Insert Location: 1343488 PA14_15780 +
Default Offset Location: 1343483 PA14_15780 +
PA14 BLAST Hit ID: 25497       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.69%
Query Start: 121 Query End: 154 Subject Start: 514553 Subject End: 514586 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 514553
Raw Sequence Start: 514423 PA14_05800*,PA14_05810 -,+
Extrapolated Insert Location: 514481
Default Offset Location: 514486
PA14 BLAST Hit ID: 25498       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 6047347 Subject End: 6047375 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6047347
Raw Sequence Start: 6047216 PA14_67690* -
Extrapolated Insert Location: 6047274 PA14_67690* -
Default Offset Location: 6047279 PA14_67690* -
PA14 BLAST Hit ID: 25499       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 5633182 Subject End: 5633210 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5633182
Raw Sequence Start: 5633051 PA14_63100 +
Extrapolated Insert Location: 5633109 PA14_63100 +
Default Offset Location: 5633114 PA14_63100 +
PA14 BLAST Hit ID: 25500       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 5021929 Subject End: 5021957 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5021929
Raw Sequence Start: 5021798 PA14_56230*,PA14_56240 -,+
Extrapolated Insert Location: 5021856
Default Offset Location: 5021861
PA14 BLAST Hit ID: 25501       Show Transposon Map
Identities: 33/37 (89.18%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 5.11%
Query Start: 121 Query End: 157 Subject Start: 5002740 Subject End: 5002776 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5002740
Raw Sequence Start: 5002610 PA14_56010 +
Extrapolated Insert Location: 5002668 PA14_56010 +
Default Offset Location: 5002673 PA14_56010 +
PA14 BLAST Hit ID: 25502       Show Transposon Map
Identities: 24/25 (96.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.41%
Query Start: 124 Query End: 148 Subject Start: 5000642 Subject End: 5000618 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5000642 PA14_55990* +
Raw Sequence Start: 5000775
Extrapolated Insert Location: 5000717 PA14_55990* +
Default Offset Location: 5000712 PA14_55990* +
PA14 BLAST Hit ID: 25503       Show Transposon Map
Identities: 30/33 (90.90%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.55%
Query Start: 122 Query End: 154 Subject Start: 4160453 Subject End: 4160485 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4160453
Raw Sequence Start: 4160322
Extrapolated Insert Location: 4160380
Default Offset Location: 4160385
PA14 BLAST Hit ID: 25504       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 3752271 Subject End: 3752299 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3752271
Raw Sequence Start: 3752140
Extrapolated Insert Location: 3752198
Default Offset Location: 3752203
PA14 BLAST Hit ID: 25505       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 3752150 Subject End: 3752178 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3752150
Raw Sequence Start: 3752019 PA14_42060 +
Extrapolated Insert Location: 3752077
Default Offset Location: 3752082
PA14 BLAST Hit ID: 25506       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 849936 Subject End: 849964 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 849936
Raw Sequence Start: 849805
Extrapolated Insert Location: 849863
Default Offset Location: 849868
PA14 BLAST Hit ID: 25507       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.27%
Query Start: 127 Query End: 150 Subject Start: 6047207 Subject End: 6047230 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6047207 PA14_67690* -
Raw Sequence Start: 6047071 PA14_67690* -
Extrapolated Insert Location: 6047129 PA14_67690* -
Default Offset Location: 6047134 PA14_67690* -
PA14 BLAST Hit ID: 25508       Show Transposon Map
Identities: 32/36 (88.88%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 121 Query End: 156 Subject Start: 5633211 Subject End: 5633176 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5633211
Raw Sequence Start: 5633341
Extrapolated Insert Location: 5633283
Default Offset Location: 5633278
PAO1 BLAST Hit ID: 25509       Show Transposon Map
Identities: 641/649 (98.76%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 92.05%
Query Start: 48 Query End: 696 Subject Start: 530079 Subject End: 529431 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 530079 PA0470 +
Raw Sequence Start: 530136 PA0470 +
Extrapolated Insert Location: 530078 PA0470 +
Default Offset Location: 530073 PA0470 +
PAO1 BLAST Hit ID: 25510       Show Transposon Map
Identities: 29/29 (100.00%) BLAST Bit Score: 58.0 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 117 Query End: 145 Subject Start: 3043442 Subject End: 3043470 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3043442
Raw Sequence Start: 3043316 PA2689 +
Extrapolated Insert Location: 3043374 PA2689 +
Default Offset Location: 3043379 PA2689 +
PAO1 BLAST Hit ID: 25511       Show Transposon Map
Identities: 35/38 (92.10%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 5.26%
Query Start: 118 Query End: 155 Subject Start: 4528445 Subject End: 4528482 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4528445
Raw Sequence Start: 4528318 PA4044 +
Extrapolated Insert Location: 4528376 PA4044 +
Default Offset Location: 4528381 PA4044 +
PAO1 BLAST Hit ID: 25512       Show Transposon Map
Identities: 35/38 (92.10%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 5.26%
Query Start: 121 Query End: 158 Subject Start: 950883 Subject End: 950846 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 950883
Raw Sequence Start: 951013 PA0870 +
Extrapolated Insert Location: 950955
Default Offset Location: 950950
PAO1 BLAST Hit ID: 25513       Show Transposon Map
Identities: 28/29 (96.55%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 5779707 Subject End: 5779735 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5779707
Raw Sequence Start: 5779576 PA5131 +
Extrapolated Insert Location: 5779634 PA5131 +
Default Offset Location: 5779639 PA5131 +
PAO1 BLAST Hit ID: 25514       Show Transposon Map
Identities: 28/29 (96.55%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 4699912 Subject End: 4699884 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4699912
Raw Sequence Start: 4700043 PA4200 -
Extrapolated Insert Location: 4699985
Default Offset Location: 4699980
PAO1 BLAST Hit ID: 25515       Show Transposon Map
Identities: 28/29 (96.55%) BLAST Bit Score: 50.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 1882533 Subject End: 1882505 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1882533
Raw Sequence Start: 1882664 PA1738 +
Extrapolated Insert Location: 1882606 PA1738 +
Default Offset Location: 1882601 PA1738 +
PAO1 BLAST Hit ID: 25516       Show Transposon Map
Identities: 30/32 (93.75%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 4.40%
Query Start: 121 Query End: 152 Subject Start: 5779736 Subject End: 5779705 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5779736
Raw Sequence Start: 5779866
Extrapolated Insert Location: 5779808
Default Offset Location: 5779803
PAO1 BLAST Hit ID: 25517       Show Transposon Map
Identities: 27/28 (96.42%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 3.84%
Query Start: 122 Query End: 149 Subject Start: 2260725 Subject End: 2260698 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2260725
Raw Sequence Start: 2260856
Extrapolated Insert Location: 2260798
Default Offset Location: 2260793
PAO1 BLAST Hit ID: 25518       Show Transposon Map
Identities: 33/36 (91.66%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 119 Query End: 154 Subject Start: 521568 Subject End: 521603 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 521568
Raw Sequence Start: 521440
Extrapolated Insert Location: 521498
Default Offset Location: 521503
PAO1 BLAST Hit ID: 25519       Show Transposon Map
Identities: 33/36 (91.66%) BLAST Bit Score: 48.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 119 Query End: 154 Subject Start: 521451 Subject End: 521486 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 521451
Raw Sequence Start: 521323
Extrapolated Insert Location: 521381
Default Offset Location: 521386
PAO1 BLAST Hit ID: 25520       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.69%
Query Start: 121 Query End: 154 Subject Start: 3843629 Subject End: 3843596 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3843629
Raw Sequence Start: 3843759 PA3435 +
Extrapolated Insert Location: 3843701 PA3435 +
Default Offset Location: 3843696 PA3435 +
PAO1 BLAST Hit ID: 25521       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.69%
Query Start: 121 Query End: 154 Subject Start: 1882504 Subject End: 1882537 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1882504
Raw Sequence Start: 1882374
Extrapolated Insert Location: 1882432
Default Offset Location: 1882437
PAO1 BLAST Hit ID: 25522       Show Transposon Map
Identities: 31/34 (91.17%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 4.69%
Query Start: 121 Query End: 154 Subject Start: 501274 Subject End: 501307 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 501274
Raw Sequence Start: 501144
Extrapolated Insert Location: 501202
Default Offset Location: 501207
PAO1 BLAST Hit ID: 25523       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 5775093 Subject End: 5775121 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5775093
Raw Sequence Start: 5774962
Extrapolated Insert Location: 5775020
Default Offset Location: 5775025
PAO1 BLAST Hit ID: 25524       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 5774948 Subject End: 5774976 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5774948
Raw Sequence Start: 5774817
Extrapolated Insert Location: 5774875
Default Offset Location: 5774880
PAO1 BLAST Hit ID: 25525       Show Transposon Map
Identities: 30/33 (90.90%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.55%
Query Start: 122 Query End: 154 Subject Start: 5050741 Subject End: 5050773 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5050741
Raw Sequence Start: 5050610 PA4512 +
Extrapolated Insert Location: 5050668
Default Offset Location: 5050673
PAO1 BLAST Hit ID: 25526       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 4837206 Subject End: 4837178 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4837206
Raw Sequence Start: 4837337
Extrapolated Insert Location: 4837279
Default Offset Location: 4837274
PAO1 BLAST Hit ID: 25527       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 4672762 Subject End: 4672734 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4672762
Raw Sequence Start: 4672893
Extrapolated Insert Location: 4672835
Default Offset Location: 4672830
PAO1 BLAST Hit ID: 25528       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 4214616 Subject End: 4214588 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4214616
Raw Sequence Start: 4214747
Extrapolated Insert Location: 4214689
Default Offset Location: 4214684
PAO1 BLAST Hit ID: 25529       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 3843499 Subject End: 3843527 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3843499
Raw Sequence Start: 3843368
Extrapolated Insert Location: 3843426
Default Offset Location: 3843431
PAO1 BLAST Hit ID: 25530       Show Transposon Map
Identities: 30/33 (90.90%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.55%
Query Start: 122 Query End: 154 Subject Start: 3843527 Subject End: 3843495 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3843527
Raw Sequence Start: 3843658 PA3435 +
Extrapolated Insert Location: 3843600
Default Offset Location: 3843595
PAO1 BLAST Hit ID: 25531       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 3841925 Subject End: 3841953 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3841925
Raw Sequence Start: 3841794
Extrapolated Insert Location: 3841852
Default Offset Location: 3841857
PAO1 BLAST Hit ID: 25532       Show Transposon Map
Identities: 30/33 (90.90%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.55%
Query Start: 122 Query End: 154 Subject Start: 3841953 Subject End: 3841921 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3841953
Raw Sequence Start: 3842084
Extrapolated Insert Location: 3842026
Default Offset Location: 3842021
PAO1 BLAST Hit ID: 25533       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 3.98%
Query Start: 122 Query End: 150 Subject Start: 3841824 Subject End: 3841852 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3841824
Raw Sequence Start: 3841693 PA3433 +
Extrapolated Insert Location: 3841751
Default Offset Location: 3841756
PAO1 BLAST Hit ID: 25534       Show Transposon Map
Identities: 30/33 (90.90%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 4.55%
Query Start: 122 Query End: 154 Subject Start: 3841852 Subject End: 3841820 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3841852
Raw Sequence Start: 3841983
Extrapolated Insert Location: 3841925
Default Offset Location: 3841920
PAO1 BLAST Hit ID: 25535       Show Transposon Map
Identities: 32/36 (88.88%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 119 Query End: 154 Subject Start: 4699881 Subject End: 4699916 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4699881
Raw Sequence Start: 4699753 PA4199 +
Extrapolated Insert Location: 4699811
Default Offset Location: 4699816
PAO1 BLAST Hit ID: 25536       Show Transposon Map
Identities: 35/40 (87.50%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.54%
Query Start: 115 Query End: 154 Subject Start: 4672727 Subject End: 4672766 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4672727
Raw Sequence Start: 4672603 PA4175 +
Extrapolated Insert Location: 4672661 PA4175 +
Default Offset Location: 4672666 PA4175 +
PAO1 BLAST Hit ID: 25537       Show Transposon Map
Identities: 32/36 (88.88%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.97%
Query Start: 121 Query End: 156 Subject Start: 1248707 Subject End: 1248672 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1248707
Raw Sequence Start: 1248837
Extrapolated Insert Location: 1248779
Default Offset Location: 1248774
H PA14 Blast Hit H PAO1 Blast Hit