Mutant Report for Mutant ID: 25822

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9598
Chromat Path: H:\Pa14\MrT7\269v1\269v1_H10_H10_092.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGGCC
TGGCCATGCTCTCCGCGCACAAGGGCGCCAAAGGTGAGGAGATCGCCAGGCTCGGGGTCACCTTCCTGCT
CGGCGCCGCGTTCATCGGCATGGAGATCAACGAGTTCCACCACCTGATCGCCGAAGGTTTCGGCCCGAGC
CGCAGCGCCTTCCTGTCGTCCTTCTTCACCCTGGTCGGCATACCCCCCCCCCCCATCATCTGCAGGCCTG
GCCAAANNNNNNNNNNNNANGNNNNANATNNTNNANNANNNNNNNNNNNNNNNANNAAAANANNAGAAAN
AANANANAAGGAAANGGAAAGGGAAAAAAAANGAAATGGAAAGGATGAGGAGGGGGAAGAGTATAAAAAA
TGAAAGGAGAAAAGGAAGGAATATGGATTAAATTGTAGATGGGGAGTAAAAAAATATGAGGGGTGTGGTA
TGTTATTATAAGTGTTGGTGTAAATGGAGGAGTTTAATTGTGTTGAGAATTTAATTGTTAGTAGATTTTA
TTATATATTGATGATTAATTTTTGTGATTTTTTAAGTTGTAAGTTATATATAGGGGGTGTGTATTTATGT
TGTTTTGTGGTTTAAAAAATTGGGTGGGAGAGATTGTGTTTATATTTTTAGTTGAATAAATAATGAAAGA
TATAAATGTGTTGTTTGTTAATATAAAGGTGTAAATGGTAATAAATTTAAGTAAAAATTTTTTGTTTGGG
GTGTGTATATATAGAAGTATAATTATGGATTAAATATTATTTTGAATTAATTATTTAGAAATAAATTTTT
TTTAATAAGTAATGGATTGTAGAGGAAGAAGAGAAAAGAATTGTGTGTCTATTTTATTATGTGGGAGATT
TTATTTAA
Blast against PA14
Processed Seqquence ID: 5737
5' Trim Position: 4 3' Trim Position: 286
Processed Sequence:
(Transposon Sequence in Red)
CAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGGCCTGGC
CATGCTCTCCGCGCACAAGGGCGCCAAAGGTGAGGAGATCGCCAGGCTCGGGGTCACCTTCCTGCTCGGC
GCCGCGTTCATCGGCATGGAGATCAACGAGTTCCACCACCTGATCGCCGAAGGTTTCGGCCCGAGCCGCA
GCGCCTTCCTGTCGTCCTTCTTCACCCTGGTCGGCATACCCCCCCCCCCCATCATCTGCAGGCCTGGCCA
AA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
25315 25315 25316 25316
PA14 BLAST Hit ID: 25315       Show Transposon Map
Identities: 184/188 (97.87%) BLAST Bit Score: 341.0 Percent of Processed Sequence That Aligns: 66.31%
Query Start: 60 Query End: 247 Subject Start: 4203310 Subject End: 4203123 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4203310 PA14_47180,PA14_47170* +,-
Raw Sequence Start: 4203373 PA14_47180,PA14_47170* +,-
Extrapolated Insert Location: 4203309 PA14_47180,PA14_47170* +,-
Default Offset Location: 4203310 PA14_47180,PA14_47170* +,-
PAO1 BLAST Hit ID: 25316       Show Transposon Map
Identities: 181/188 (96.27%) BLAST Bit Score: 317.0 Percent of Processed Sequence That Aligns: 66.31%
Query Start: 60 Query End: 247 Subject Start: 1431323 Subject End: 1431510 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1431323 PA1319 +
Raw Sequence Start: 1431260 PA1319 +
Extrapolated Insert Location: 1431324 PA1319 +
Default Offset Location: 1431323 PA1319 +
H PA14 Blast Hit H PAO1 Blast Hit