Mutant Report for Mutant ID: 25565

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9341
Chromat Path: H:\Pa14\MrT7\267v1\267v1_C05_C5_038.ab1 Last Transposon Base: 58 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
ACGTTTGTTACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCCGGCGCGGA
TGGGCGTGGAGATGGACGAGGCGTTCTTCGCCGCCGTCGCCAGCTGCCGCAACATCGTCGCGATCAAGGA
AAGCTCCGGCTCCACCGCGCAATTGCACCGCCTGGCCTGCCGCCACCCGCGGATCGCCTTGTCCTGCGGC
TGGGACGACCAGGCCCTGGAGTTCTTCGCCTGGGGCGCGCGCAGTTGGGTCTGCGCCGGCTCCAACTTCA
TCCCTGGCGAACACCTCGCCCTGTACCAGGCCTGCGTGGTCGAGAACGACTTCGCCAAGGGCCGGCGCAT
CATGGCGGCGATGATGCCGCTGATGGACTTTCTCGAAAGCGGTCACTTCGTCCAGTCGATCAAGCACGGC
TGCGAGCTGGCCGGCCTGCGCGCCGGCGGCGTACGTGCGCCGCTGAAGGCGCTGGACGAGGCCGGCAAGG
CGGCACTGGCGGAGATCGTCGCCAGGCTCAAGGGCGAGGTCGCGCGGATCGTCGAGGGTGGCCGCCATGA
CTGAGCTGCTGAGCCGGGAGGAATACGCGGCCATCGCCGCGACGCTGGACCTTCCCCAGCGCGCCTTCAT
CGACGGAGGGTTCCGCGATGCCTGCGGCGGCCGCACCTTCGCCTCGACCACCCGGGCACCGGCGAGCTGC
TGGCGCAGGTCGCCGCCTGCGACGCGAAGGACGTCTGGCACCGCGTGGCCAGCGCGCGGCGGGCGTTTCG
AGGAGGCCGCTTGCGCTTCCGCACGCCCCCCAACGAAAGGCGCCCTTCTTCCCCTGGCCAGCTTGCTGAA
GAACACCTGCTGGAACTGGCGGTGATGGAAAGCTCCACAGCGGCAACCG
Blast against PA14
Processed Seqquence ID: 5496
5' Trim Position: 9 3' Trim Position: 634
Processed Sequence:
(Transposon Sequence in Red)
ACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCCGGCGCGGATGGGCGTGG
AGATGGACGAGGCGTTCTTCGCCGCCGTCGCCAGCTGCCGCAACATCGTCGCGATCAAGGAAAGCTCCGG
CTCCACCGCGCAATTGCACCGCCTGGCCTGCCGCCACCCGCGGATCGCCTTGTCCTGCGGCTGGGACGAC
CAGGCCCTGGAGTTCTTCGCCTGGGGCGCGCGCAGTTGGGTCTGCGCCGGCTCCAACTTCATCCCTGGCG
AACACCTCGCCCTGTACCAGGCCTGCGTGGTCGAGAACGACTTCGCCAAGGGCCGGCGCATCATGGCGGC
GATGATGCCGCTGATGGACTTTCTCGAAAGCGGTCACTTCGTCCAGTCGATCAAGCACGGCTGCGAGCTG
GCCGGCCTGCGCGCCGGCGGCGTACGTGCGCCGCTGAAGGCGCTGGACGAGGCCGGCAAGGCGGCACTGG
CGGAGATCGTCGCCAGGCTCAAGGGCGAGGTCGCGCGGATCGTCGAGGGTGGCCGCCATGACTGAGCTGC
TGAGCCGGGAGGAATACGCGGCCATCGCCGCGACGCTGGACCTTCCCCAGCGCGCCTTCATCGAC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
23997 23997 23998 23998
PA14 BLAST Hit ID: 23997       Show Transposon Map
Identities: 576/577 (99.82%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 92.16%
Query Start: 49 Query End: 625 Subject Start: 837195 Subject End: 836619 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 837195 PA14_09720*,PA14_09730 -,+
Raw Sequence Start: 837252 PA14_09720*,PA14_09730 -,+
Extrapolated Insert Location: 837194 PA14_09720*,PA14_09730 -,+
Default Offset Location: 837189 PA14_09720*,PA14_09730 -,+
PAO1 BLAST Hit ID: 23998       Show Transposon Map
Identities: 576/577 (99.82%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 92.16%
Query Start: 49 Query End: 625 Subject Start: 4685494 Subject End: 4686070 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4685494 PA4188 +
Raw Sequence Start: 4685437 PA4188 +
Extrapolated Insert Location: 4685495 PA4188 +
Default Offset Location: 4685500 PA4188 +
H PA14 Blast Hit H PAO1 Blast Hit