Mutant Report for Mutant ID: 25468

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9244
Chromat Path: H:\Pa14\MrT7\266v1\266v1_C04_C4_024.ab1 Last Transposon Base: 59 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCACCCTTGC
CCTCGGTGATTGCGGCCTCGACCGCGCTGGTGTCGATCACCCCGGCGAAGGCCGGCAGCGAAGTCGCGGC
AGTGACGGAACCGGCGATGCACAGGTTGCGGAACGAGGCGACCGGGCTGAACTTGGCGATGCGTTGCTTC
ATTGCTTTCATGGTGTTTCCTCTCTATTTGGCTTTACGAAGAAGTGACGCGACCCAGCCAATCAAAAGCC
CCGTCACGAACGATCCCAGGACGCCAGCGGCACCGATGCCGAAGGCTTCCGGGGAGAAACCACCGTTGAC
CAGGATGTCCACGTATACNGCGCCCCCCCATCATCTGCAGGGCCTGGCCAAANNNNNNNNNNTNNNNNNN
NNNNNNTNNNNNNNNNNNNNNTNNNNNNNNTTTNNNNTTTNTTTTTTTTNTTTTTTTTTTTTTTTTTTTT
TTTTTTTTNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTTTTTTTTTTTTTNTNTTTTTTTTTTTTTTTTTTTTNTTTTTTTTTTTTTTTTTTTTTTTTTTTNT
TTTTTTTTTTTTTTTTTTTTTTTTTTTNTTTTTTTTTTNTTTTTTTTTTTTTTTTTTTTTTTTTTTTTNT
TTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTTTTTTTTTAATTTTTTTTTT
TTTTNTTTTTTTTTTNTNGTTTTTTTTGTTTTTTTNNTTTTTTTATTTTGTTTTTTTTTTTTAATTATAN
T
Blast against PA14
Processed Seqquence ID: 5404
5' Trim Position: 9 3' Trim Position: 392
Processed Sequence:
(Transposon Sequence in Red)
TACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATCACCCTTGCCCTCGGTGA
TTGCGGCCTCGACCGCGCTGGTGTCGATCACCCCGGCGAAGGCCGGCAGCGAAGTCGCGGCAGTGACGGA
ACCGGCGATGCACAGGTTGCGGAACGAGGCGACCGGGCTGAACTTGGCGATGCGTTGCTTCATTGCTTTC
ATGGTGTTTCCTCTCTATTTGGCTTTACGAAGAAGTGACGCGACCCAGCCAATCAAAAGCCCCGTCACGA
ACGATCCCAGGACGCCAGCGGCACCGATGCCGAAGGCTTCCGGGGAGAAACCACCGTTGACCAGGATGTC
CACGTATACNGCGCCCCCCCATCATCTGCAGGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
23595 23595 23596 23596 23597 23597
PA14 BLAST Hit ID: 23595       Show Transposon Map
Identities: 308/308 (100.00%) BLAST Bit Score: 611.0 Percent of Processed Sequence That Aligns: 80.16%
Query Start: 50 Query End: 357 Subject Start: 4350937 Subject End: 4351244 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4350937 PA14_48940 -
Raw Sequence Start: 4350879 PA14_48940 -
Extrapolated Insert Location: 4350938 PA14_48940 -
Default Offset Location: 4350942 PA14_48940 -
PAO1 BLAST Hit ID: 23596       Show Transposon Map
Identities: 275/276 (99.63%) BLAST Bit Score: 539.0 Percent of Processed Sequence That Aligns: 71.80%
Query Start: 82 Query End: 357 Subject Start: 791116 Subject End: 790841 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 791116 PA0723 -
Raw Sequence Start: 791206 PA0723 -
Extrapolated Insert Location: 791147 PA0723 -
Default Offset Location: 791143 PA0723 -
PAO1 BLAST Hit ID: 23597       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.96%
Query Start: 56 Query End: 75 Subject Start: 5825671 Subject End: 5825652 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5825671 PA5173 -
Raw Sequence Start: 5825735
Extrapolated Insert Location: 5825676 PA5173 -
Default Offset Location: 5825672 PA5173 -
H PA14 Blast Hit H PAO1 Blast Hit