Mutant Report for Mutant ID: 25284

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9060
Chromat Path: H:\Pa14\MrT7\264v1\264v1_C12_C12_098.ab1 Last Transposon Base: 61 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CCGTTTGTATACGACTCACTATAGGGTGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGTGAAGGG
CACGCCGAACAAGGCGCTGGCGGAGAAATTCATCGCCTTCGTCAACCAGCCGCAGACGCAGAAGGTGTTC
TCCGAGCAGATCCCCTACGGGCCGGTACACAAGGGCACCCTGGCGTTGCTGCCGAAGACGGTGCAGGAGG
CGCTGCCGACCGCGCCGGCCAACCTCGAAGGCGCGCGGGCGGTGGATGCCGAGTTCTGGGTGGACCACGG
CGAGGAGCTGGAACAGCGTTTCAATGCCTGGGCGGCGCGCTGAGCGCGCTGCGCGTCGGCAAAAAAACGA
CGGGCCCCCAGTCGTCCGGGCCCGTCGGGTCAAAGCGCTGACGGGGTGATCAGCGCAGTTCTTCCAACAA
CCCCTGCAGATACCCCCCCCCCTCATATCTGGGGGGCTGGGCAACTNNNNTNTTTTTTNNNNNNNNNNNN
NNNNNTTNTTCCTTTCCGTGTCTTTTTTGTTTGTTCGTTGTTCCCGTGTTTGGGGTGTTGTCCGTCCCTG
GTTCTTCTTGCCCGTTGGCTGGCTTGGGGGCCTTCCCCGGTGCCGCCCTTCTCCGGTTGTGGTGGGTTGT
GCCTTGTGGTTTTTTGGTCTTTGTTGTGGCTGTGTTGTTTTCTTCTTTTTTCCCTGGTGCCCGTGGTGCT
CTTGGTGTGGCGGTTTGTTGGCTCTTGGTTTTTGTGTCTCTCTGCCCTTCGTTGTTTGGTCCTCGTTTGT
GGTGTGTGTGGGTTTTTGCGCGTTCCTTGTTTTGGCGTTGGCCGTCGGTCTCCGCGCTGTTTTTTTTTTC
GTGTGGTTGTTGTGGGGTGTGTGTGTGGCGTCTTCGTGCTGTTTTTTTTCT
Blast against PA14
Processed Seqquence ID: 5236
5' Trim Position: 26 3' Trim Position: 331
Processed Sequence:
(Transposon Sequence in Red)
TGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGTGAAGGGCACGCCGAACAAGGCGCTGGCGGAGA
AATTCATCGCCTTCGTCAACCAGCCGCAGACGCAGAAGGTGTTCTCCGAGCAGATCCCCTACGGGCCGGT
ACACAAGGGCACCCTGGCGTTGCTGCCGAAGACGGTGCAGGAGGCGCTGCCGACCGCGCCGGCCAACCTC
GAAGGCGCGCGGGCGGTGGATGCCGAGTTCTGGGTGGACCACGGCGAGGAGCTGGAACAGCGTTTCAATG
CCTGGGCGGCGCGCTGAGCGCGCTG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
22869 22869 22870 22870 22871 22871 22872 22872 22873 22873 22874 22874 22875 22875 22876 22876
PA14 BLAST Hit ID: 22869       Show Transposon Map
Identities: 270/271 (99.63%) BLAST Bit Score: 529.0 Percent of Processed Sequence That Aligns: 88.52%
Query Start: 35 Query End: 305 Subject Start: 242724 Subject End: 242994 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 242724 PA14_02710*,PA14_02720 -,+
Raw Sequence Start: 242664 PA14_02710*,PA14_02720 -,+
Extrapolated Insert Location: 242725 PA14_02710*,PA14_02720 -,+
Default Offset Location: 242727 PA14_02710*,PA14_02720 -,+
PA14 BLAST Hit ID: 22870       Show Transposon Map
Identities: 43/50 (86.00%) BLAST Bit Score: 44.1 Percent of Processed Sequence That Aligns: 16.07%
Query Start: 238 Query End: 287 Subject Start: 5871340 Subject End: 5871291 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5871340 PA14_65920,PA14_65910* +,-
Raw Sequence Start: 5871603 PA14_65920,PA14_65910* +,-
Extrapolated Insert Location: 5871542 PA14_65920,PA14_65910* +,-
Default Offset Location: 5871540 PA14_65920,PA14_65910* +,-
PA14 BLAST Hit ID: 22871       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 9.18%
Query Start: 262 Query End: 290 Subject Start: 679780 Subject End: 679808 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 679780 PA14_07870 +
Raw Sequence Start: 679493 PA14_07870 +
Extrapolated Insert Location: 679554 PA14_07870 +
Default Offset Location: 679556 PA14_07870 +
PA14 BLAST Hit ID: 22872       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 6.23%
Query Start: 249 Query End: 268 Subject Start: 103860 Subject End: 103879 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 103860 PA14_01070 +
Raw Sequence Start: 103586 PA14_01070 +
Extrapolated Insert Location: 103647 PA14_01070 +
Default Offset Location: 103649 PA14_01070 +
PAO1 BLAST Hit ID: 22873       Show Transposon Map
Identities: 266/269 (98.88%) BLAST Bit Score: 509.0 Percent of Processed Sequence That Aligns: 87.87%
Query Start: 37 Query End: 305 Subject Start: 252575 Subject End: 252843 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 252575 PA0222 +
Raw Sequence Start: 252513 PA0222 +
Extrapolated Insert Location: 252574 PA0222 +
Default Offset Location: 252576 PA0222 +
PAO1 BLAST Hit ID: 22874       Show Transposon Map
Identities: 44/50 (88.00%) BLAST Bit Score: 52.0 Percent of Processed Sequence That Aligns: 16.07%
Query Start: 238 Query End: 287 Subject Start: 5599942 Subject End: 5599893 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 5599942 PA4985 +
Raw Sequence Start: 5600205 PA4985 +
Extrapolated Insert Location: 5600144 PA4985 +
Default Offset Location: 5600142 PA4985 +
PAO1 BLAST Hit ID: 22875       Show Transposon Map
Identities: 27/29 (93.10%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 9.18%
Query Start: 262 Query End: 290 Subject Start: 666959 Subject End: 666987 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 666959 PA0604 +
Raw Sequence Start: 666672 PA0604 +
Extrapolated Insert Location: 666733 PA0604 +
Default Offset Location: 666735 PA0604 +
PAO1 BLAST Hit ID: 22876       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 6.23%
Query Start: 249 Query End: 268 Subject Start: 106207 Subject End: 106226 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 106207 PA0088 +
Raw Sequence Start: 105933 PA0088 +
Extrapolated Insert Location: 105994 PA0088 +
Default Offset Location: 105996 PA0088 +
H PA14 Blast Hit H PAO1 Blast Hit