Mutant Report for Mutant ID: 25280

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 9056
Chromat Path: H:\Pa14\MrT7\264v1\264v1_C08_C8_066.ab1 Last Transposon Base: 59 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGCCTACCGC
TCCGCGGCCGAGGGCACGCTGGACAACTCCGACCTTTCGAAGATCGACGGCTACGCCCTGGTGAACCTCG
CCGCCGGCCTGCGCAGCGATCTCGGCGACGGCCAACTGGACACCTCGGTATGGCTGAAGAACGCCTTCGA
CAAGGACTACTACCTGAGCGCCTTCGCCAGCATCAACGGCTCCTACACCGCATCGGTGGGACAGCCGCGC
ACGCTCGGCGTATCGCTGCGCTACGACTTCTGAGCCTTCACCCACGCAGTACCCCACGCATGAGGAACAT
GACATGAGCAATGCAGCACAAGCCCTCGCCACGCCGGTACGGCTCGACGTCCGGCCGGTCGCCGGACGGA
TCGGCGCGGAGATTCGCGGCGTGACCCTGTCCGGCGAACTGGACGCCGCCACCGTCGAGGCGATCCAGGC
CGCCCTGGTACGCCACAAGGTGATCTTCTTCCGGGACCAGAGCCATCTCGACGACCAGACCCAGGAGGCC
TTCGCCCACTTGCTCGGCGAACCGGTCGCCCACCCCACAGTGCCGTCCCGCGAAGGCACCCGCTTCCTCC
TCGAGCTGGATGGCGCCGAAAGCCGCCGGGCCAACTCCTGGCATACCGGCGTGCACCATCTCTGGGGGGG
GCTTGGCCAGNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNGNNNNNNNGGGGNGGNNNGGNNGGGGGNN
NNGGGGNGGGGGNNNNGNGGGGNNGGGNGGNNGGGGNNGNGGNGNGNNGGNGGNNNGGGNNNGGGGGGGG
GGGNGNGNNGGGGGGGGGNGNGGGGGGGGGGNNNNGNNNGGGNNNNNGNNGGGGGGGNGGGGGGGGGGGG
G
Blast against PA14
Processed Seqquence ID: 5232
5' Trim Position: 4 3' Trim Position: 679
Processed Sequence:
(Transposon Sequence in Red)
TTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGCCTACCGCTCCG
CGGCCGAGGGCACGCTGGACAACTCCGACCTTTCGAAGATCGACGGCTACGCCCTGGTGAACCTCGCCGC
CGGCCTGCGCAGCGATCTCGGCGACGGCCAACTGGACACCTCGGTATGGCTGAAGAACGCCTTCGACAAG
GACTACTACCTGAGCGCCTTCGCCAGCATCAACGGCTCCTACACCGCATCGGTGGGACAGCCGCGCACGC
TCGGCGTATCGCTGCGCTACGACTTCTGAGCCTTCACCCACGCAGTACCCCACGCATGAGGAACATGACA
TGAGCAATGCAGCACAAGCCCTCGCCACGCCGGTACGGCTCGACGTCCGGCCGGTCGCCGGACGGATCGG
CGCGGAGATTCGCGGCGTGACCCTGTCCGGCGAACTGGACGCCGCCACCGTCGAGGCGATCCAGGCCGCC
CTGGTACGCCACAAGGTGATCTTCTTCCGGGACCAGAGCCATCTCGACGACCAGACCCAGGAGGCCTTCG
CCCACTTGCTCGGCGAACCGGTCGCCCACCCCACAGTGCCGTCCCGCGAAGGCACCCGCTTCCTCCTCGA
GCTGGATGGCGCCGAAAGCCGCCGGGCCAACTCCTGGCATACCGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
22847 22847 22848 22848 22849 22849 22850 22850 22851 22851 22852 22852 22853 22853 22854 22854 22855 22855 22856 22856
PA14 BLAST Hit ID: 22847       Show Transposon Map
Identities: 619/620 (99.83%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.70%
Query Start: 55 Query End: 674 Subject Start: 218026 Subject End: 218645 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 218026 PA14_02400*,PA14_02410 -,+
Raw Sequence Start: 217968 PA14_02400*,PA14_02410 -,+
Extrapolated Insert Location: 218027 PA14_02400*,PA14_02410 -,+
Default Offset Location: 218031 PA14_02400*,PA14_02410 -,+
PA14 BLAST Hit ID: 22848       Show Transposon Map
Identities: 23/23 (100.00%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 3.26%
Query Start: 122 Query End: 144 Subject Start: 4788254 Subject End: 4788276 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4788254 PA14_53980,PA14_53990* +,-
Raw Sequence Start: 4788129 PA14_53980,PA14_53990* +,-
Extrapolated Insert Location: 4788188 PA14_53980,PA14_53990* +,-
Default Offset Location: 4788192 PA14_53980,PA14_53990* +,-
PA14 BLAST Hit ID: 22849       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 2.96%
Query Start: 157 Query End: 177 Subject Start: 4740299 Subject End: 4740319 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4740299 PA14_53480 +
Raw Sequence Start: 4740139 PA14_53480 +
Extrapolated Insert Location: 4740198 PA14_53480 +
Default Offset Location: 4740202 PA14_53480 +
PA14 BLAST Hit ID: 22850       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.41%
Query Start: 434 Query End: 457 Subject Start: 1227889 Subject End: 1227866 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1227889 PA14_14390 +
Raw Sequence Start: 1228326 PA14_14390 +
Extrapolated Insert Location: 1228267 PA14_14390 +
Default Offset Location: 1228263 PA14_14390 +
PAO1 BLAST Hit ID: 22851       Show Transposon Map
Identities: 612/620 (98.70%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.70%
Query Start: 55 Query End: 674 Subject Start: 221290 Subject End: 221909 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 221290 PA0192 +
Raw Sequence Start: 221232 PA0192 +
Extrapolated Insert Location: 221291 PA0192 +
Default Offset Location: 221295 PA0192 +
PAO1 BLAST Hit ID: 22852       Show Transposon Map
Identities: 23/23 (100.00%) BLAST Bit Score: 46.1 Percent of Processed Sequence That Aligns: 3.26%
Query Start: 122 Query End: 144 Subject Start: 869133 Subject End: 869111 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 869133 PA0793 +
Raw Sequence Start: 869258 PA0793 +
Extrapolated Insert Location: 869199 PA0793 +
Default Offset Location: 869195 PA0793 +
PAO1 BLAST Hit ID: 22853       Show Transposon Map
Identities: 21/21 (100.00%) BLAST Bit Score: 42.1 Percent of Processed Sequence That Aligns: 2.96%
Query Start: 157 Query End: 177 Subject Start: 911304 Subject End: 911284 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 911304 PA0835 +
Raw Sequence Start: 911464 PA0835 +
Extrapolated Insert Location: 911405 PA0835 +
Default Offset Location: 911401 PA0835 +
PAO1 BLAST Hit ID: 22854       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.41%
Query Start: 434 Query End: 457 Subject Start: 4298173 Subject End: 4298196 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4298173 PA3836 +
Raw Sequence Start: 4297736 PA3836 +
Extrapolated Insert Location: 4297795 PA3836 +
Default Offset Location: 4297799 PA3836 +
PAO1 BLAST Hit ID: 22855       Show Transposon Map
Identities: 23/24 (95.83%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.41%
Query Start: 187 Query End: 210 Subject Start: 2579397 Subject End: 2579420 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2579397 PA2335 +
Raw Sequence Start: 2579207 PA2335 +
Extrapolated Insert Location: 2579266 PA2335 +
Default Offset Location: 2579270 PA2335 +
PAO1 BLAST Hit ID: 22856       Show Transposon Map
Identities: 35/40 (87.50%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 5.78%
Query Start: 116 Query End: 155 Subject Start: 2579326 Subject End: 2579365 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2579326 PA2335 +
Raw Sequence Start: 2579207 PA2335 +
Extrapolated Insert Location: 2579266 PA2335 +
Default Offset Location: 2579270 PA2335 +
H PA14 Blast Hit H PAO1 Blast Hit