Mutant Report for Mutant ID: 25156

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 8932
Chromat Path: H:\Pa14\MrT7\263v1\263v1_A04_A4_023.ab1 Last Transposon Base: 58 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
ACGTTTGTATCGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTTCAGGTCCT
CGCGCGACGGTTTGCCGGGCTGGCTGGCGTAGTCCGGCAGGACGCTGATCGCCTGTTCCTGGTCGGGGAT
GCTGGACGGGTCGAGGTCGCCGCCGACGTTGCGCGGGTCGGTGGGGATCGCCGAGGGAATCACCACGGTG
CGCTCGGCCAGCGGCCAGCCGAGAATGGTCTCCAGGCGCCCGCCTTCCTCCTCGGGGCCGGTGATGGCGT
CCAGGCGCAGCGGCAGCGGATGGCCGATCAGCCGTTCGACCTCGCCCGCCGCCTCCGGCGCGGCCAGGGT
CAGGCCGGTGCGGTAGAAGCCCGGCAGACTCGAGCGCGGCACATAGACCCGCAGCAGGGCACCGTTGCGG
ATCCGGCCGCGCGCGTCGGGTTCCTGGTCCTGGGCGTAGCCGTAGGCCAGCGCCGGATCGCCGGCGATAT
AGAAACCGCGCCAGATCGCGTCGAGGTCCTGGCTGCGCGCGCGCACCCCGCCGAAGACGATGCTTTGCGC
CGCTTCGAGGAAGGTGCCGTGTTAGCCGACGAACACATACCCCTCGCTCCCATCTTCTGAAGGGGCCGGG
CCAAAATTNNATATTATTTGNTTTCTCATCTACAAGCACAGGAAGGACACCCGCTGAAGAGTAACACATG
GTGTCGGTATGGGCCCTCTGGCGGTGCTTTTATCGTTCCCTCTGCGCCTAGTGTGCTCTACCACGTCTCC
TCTCCTGTTATCCATTTTTTCTTTCTTATCTTTCTCTCCCTCTCTCCTTGTCTCCCTCTTTATATATCAT
CTTCTTATTTTTTCTTTTTTTTTTTATAATATTTATATTCA
Blast against PA14
Processed Seqquence ID: 5114
5' Trim Position: 17 3' Trim Position: 509
Processed Sequence:
(Transposon Sequence in Red)
TATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACTTCAGGTCCTCGCGCGACGGTTTGCCG
GGCTGGCTGGCGTAGTCCGGCAGGACGCTGATCGCCTGTTCCTGGTCGGGGATGCTGGACGGGTCGAGGT
CGCCGCCGACGTTGCGCGGGTCGGTGGGGATCGCCGAGGGAATCACCACGGTGCGCTCGGCCAGCGGCCA
GCCGAGAATGGTCTCCAGGCGCCCGCCTTCCTCCTCGGGGCCGGTGATGGCGTCCAGGCGCAGCGGCAGC
GGATGGCCGATCAGCCGTTCGACCTCGCCCGCCGCCTCCGGCGCGGCCAGGGTCAGGCCGGTGCGGTAGA
AGCCCGGCAGACTCGAGCGCGGCACATAGACCCGCAGCAGGGCACCGTTGCGGATCCGGCCGCGCGCGTC
GGGTTCCTGGTCCTGGGCGTAGCCGTAGGCCAGCGCCGGATCGCCGGCGATATAGAAACCGCGCCAGATC
GC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
22368 22368 22369 22369 22370 22370 22371 22371 22372 22372 22373 22373
PA14 BLAST Hit ID: 22368       Show Transposon Map
Identities: 451/452 (99.77%) BLAST Bit Score: 888.0 Percent of Processed Sequence That Aligns: 91.67%
Query Start: 41 Query End: 492 Subject Start: 4409347 Subject End: 4408896 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4409347 PA14_49560,PA14_49550* -,+
Raw Sequence Start: 4409404 PA14_49550* +
Extrapolated Insert Location: 4409346 PA14_49560,PA14_49550* -,+
Default Offset Location: 4409341 PA14_49560,PA14_49550* -,+
PA14 BLAST Hit ID: 22369       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.86%
Query Start: 450 Query End: 469 Subject Start: 3064258 Subject End: 3064277 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3064258 PA14_34430*,PA14_34450 +,-
Raw Sequence Start: 3063792 PA14_34430*,PA14_34450 +,-
Extrapolated Insert Location: 3063850 PA14_34430*,PA14_34450 +,-
Default Offset Location: 3063855 PA14_34430*,PA14_34450 +,-
PA14 BLAST Hit ID: 22370       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.86%
Query Start: 269 Query End: 288 Subject Start: 2324038 Subject End: 2324057 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2324038 PA14_26660*,PA14_26670,PA14_26680* -,-,+
Raw Sequence Start: 2323753 PA14_26660*,PA14_26670,PA14_26680* -,-,+
Extrapolated Insert Location: 2323811 PA14_26660*,PA14_26670,PA14_26680* -,-,+
Default Offset Location: 2323816 PA14_26660*,PA14_26670,PA14_26680* -,-,+
PAO1 BLAST Hit ID: 22371       Show Transposon Map
Identities: 451/454 (99.33%) BLAST Bit Score: 876.0 Percent of Processed Sequence That Aligns: 92.07%
Query Start: 39 Query End: 492 Subject Start: 1240583 Subject End: 1241036 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1240583
Raw Sequence Start: 1240528
Extrapolated Insert Location: 1240586 PA1148 -
Default Offset Location: 1240591 PA1148 -
PAO1 BLAST Hit ID: 22372       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.86%
Query Start: 269 Query End: 288 Subject Start: 3245320 Subject End: 3245301 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3245320 PA2891 -
Raw Sequence Start: 3245605 PA2891 -
Extrapolated Insert Location: 3245547 PA2891 -
Default Offset Location: 3245542 PA2891 -
PAO1 BLAST Hit ID: 22373       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 3.86%
Query Start: 450 Query End: 469 Subject Start: 2573896 Subject End: 2573877 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2573896 PA2332 -
Raw Sequence Start: 2574362 PA2332 -
Extrapolated Insert Location: 2574304 PA2332 -
Default Offset Location: 2574299 PA2332 -
H PA14 Blast Hit H PAO1 Blast Hit