Mutant Report for Mutant ID: 24663

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 8439
Chromat Path: H:\Pa14\MrT7\257v1\257v1_H03_H3_031.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGTGGG
CACGCAGATGGACATGCCGATCCACAGCGCGGTGATGTGCCACCTGTACCAGGTACGCTGTTCCACCCGG
GTCGGGGCGATGTCGTGGTTGTAGCGGGGACTGTCGAGTACGTCGCTGCCGGCGGACAGCTCGACCAAGC
CGTCGCGCTCGGTCACTTCCGATCTGCTCTGTTGCATGGGCCTCTCCAGAATTCTTTTAGTTATTCGCTC
ATCGGGCTAATGCTGTGGGCGGGGTCACGCACCACCAATACTGGACCGCCAATCCAGACAGTGCCGAGGC
GGGCGGAACTCGGTGAGCGAGGCGGAAACACGGCGGGGGGGTGGAAAAAAAGGGTGGGGGGGGGAAAAAG
GGGGGGAGGGGGGGGAAAAAAAAGGGGGGGGAAAAAAAAAGGGGAAAAGGGGGAAAAAGGGGGGGGGGGG
GGAAAAGGGAGAAAAGGATCGGGTGGTGGAATGTGTTATGGAAAAAAGGGAAAAAAAGGGGGGGGGGGGG
GGGGAAAAGAGGGGGGGGGGGGGGGGAGGGGGAAAAAAAAGAGGGGGGGGAAAAAAAAAAAGGGGGGGGG
GGGGGAAAAAAAAGAGGGGGGGGGGGGAAAAAAAAGGGGGGGGAAAAGGGGGGAAAAAGGGGGGAAAAAA
TAGGGATGGGGTGGGGGAAAAAAAGGGAAAAAAAGGGGGGGGGGAAAAGGGGTGTGTGGGAAAGGGGGGA
AAAAAAAGGGGGAAAAAGGGGGGGGGGAAAAAAAAAAAGAGGTGGGGAGAAAAAGGGGGGGGGGGGGAAA
ATAAAAGAAGGGGGGGGGGGGGGGGCGAGGGGGAAAAAAAAAAAAAGACTGGGGGGGTGGGGGTGAAAAA
GGAAAGGGGGGGGGGGGGGGAA
Blast against PA14
Processed Seqquence ID: 4683
5' Trim Position: 9 3' Trim Position: 564
Processed Sequence:
(Transposon Sequence in Red)
TGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTAGGTGGGCACGCAGAT
GGACATGCCGATCCACAGCGCGGTGATGTGCCACCTGTACCAGGTACGCTGTTCCACCCGGGTCGGGGCG
ATGTCGTGGTTGTAGCGGGGACTGTCGAGTACGTCGCTGCCGGCGGACAGCTCGACCAAGCCGTCGCGCT
CGGTCACTTCCGATCTGCTCTGTTGCATGGGCCTCTCCAGAATTCTTTTAGTTATTCGCTCATCGGGCTA
ATGCTGTGGGCGGGGTCACGCACCACCAATACTGGACCGCCAATCCAGACAGTGCCGAGGCGGGCGGAAC
TCGGTGAGCGAGGCGGAAACACGGCGGGGGGGTGGAAAAAAAGGGTGGGGGGGGGAAAAAGGGGGGGAGG
GGGGGGAAAAAAAAGGGGGGGGAAAAAAAAAGGGGAAAAGGGGGAAAAAGGGGGGGGGGGGGGAAAAGGG
AGAAAAGGATCGGGTGGTGGAATGTGTTATGGAAAAAAGGGAAAAAAAGGGGGGGGGGGGGGGGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
20322 20322 20323 20323
PA14 BLAST Hit ID: 20322       Show Transposon Map
Identities: 283/299 (94.64%) BLAST Bit Score: 466.0 Percent of Processed Sequence That Aligns: 53.69%
Query Start: 54 Query End: 352 Subject Start: 511806 Subject End: 511508 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 511806 PA14_05780*,PA14_05790 +,-
Raw Sequence Start: 511868 PA14_05780*,PA14_05790 +,-
Extrapolated Insert Location: 511805 PA14_05780*,PA14_05790 +,-
Default Offset Location: 511805 PA14_05780*,PA14_05790 +,-
PAO1 BLAST Hit ID: 20323       Show Transposon Map
Identities: 278/294 (94.55%) BLAST Bit Score: 456.0 Percent of Processed Sequence That Aligns: 52.79%
Query Start: 54 Query End: 347 Subject Start: 497055 Subject End: 496762 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 497055 PA0443 -
Raw Sequence Start: 497117 PA0443 -
Extrapolated Insert Location: 497054 PA0443 -
Default Offset Location: 497054 PA0443 -
H PA14 Blast Hit H PAO1 Blast Hit