Mutant Report for Mutant ID: 24637

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 8413
Chromat Path: H:\Pa14\MrT7\257v1\257v1_F01_F1_014.ab1 Last Transposon Base: 25 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
CCGGGGACTTATCAGCCAACCTGTTAGAAAAGGGAAGCTCCTTTGTCCCACCCAGACGGGTGGCCGACCT
GGCTGATGGAGCTCCACCTACTGACGCTGCCGTAGGTGACGCGGATCAAGTGATGAGCACGGACATGGTC
GTTGGGGATAGAAAAGTTTCCTCGCCATCCGGATAAGGGTGTCCTCAATGTCCATGCGCTTGAAATTGCG
GAGAAAAAAACCCGGGGCCACGCTGGAGACCCTGGACGAGAAGACCGGCCGGACCAAGAGCTACGTGTCA
CAAGAACAAACGCGGGCTGAACACGCCCTCCATTGCCACTCCTGTCCAATCTGTTCAAACTGTTGAACTT
AGCAGGTGGAGCAACAGTTCTCCTAGAAAAGCAATTGTGTTCGACCGTAACAACATCATTCCTTGCCACC
CGACCAAGACCCTTTACCACAACAACAAATGACACACAAACCCATCATAAACTCATAAGCATCCTCGGGA
AAATGTGTGACAGAGTTATAATCACTTAAATCCTTTTTTTGCGAACGAAATATTATGAATTCTGTTTATA
TTTTTCTTGTTTTATTTTATAATGTTCTTTTTTCATCTTTATTTGTAGTGGGAGGTTTATGGGCAGGGGG
ATATGTTCGTTAGCTTGCTTGAATTGCTGTCTTTTTATGTGCTTGTCTGTAATTCTTTTGACATTTTGCC
CTTTTTTTCCGGCTTTTTGTTGGCGTCACGTGGTTCCGCGACTATTATTGATACCTTTCGTTTTGACGCA
GTTTGCAATGTATGTTGGGGCTCTTGGTTGTTCCCTAGTTTCCATGTTTGAGCCTTTGGGATTTGCGCGG
TTTATATATTTATTGATTAAT
Blast against PA14
Processed Seqquence ID: 4662
5' Trim Position: 1 3' Trim Position: 267
Processed Sequence:
(Transposon Sequence in Red)
CGGGGACTTATCAGCCAACCTGTTAGAAAAGGGAAGCTCCTTTGTCCCACCCAGACGGGTGGCCGACCTG
GCTGATGGAGCTCCACCTACTGACGCTGCCGTAGGTGACGCGGATCAAGTGATGAGCACGGACATGGTCG
TTGGGGATAGAAAAGTTTCCTCGCCATCCGGATAAGGGTGTCCTCAATGTCCATGCGCTTGAAATTGCGG
AGAAAAAAACCCGGGGCCACGCTGGAGACCCTGGACGAGAAGACCGGCCGGACCAA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
20235 20235 20236 20236
PA14 BLAST Hit ID: 20235       Show Transposon Map
Identities: 102/118 (86.44%) BLAST Bit Score: 121.0 Percent of Processed Sequence That Aligns: 43.98%
Query Start: 149 Query End: 266 Subject Start: 244904 Subject End: 245021 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 244904
Raw Sequence Start: 244755 PA14_02740 -
Extrapolated Insert Location: 244780 PA14_02740 -
Default Offset Location: 244818
PAO1 BLAST Hit ID: 20236       Show Transposon Map
Identities: 102/118 (86.44%) BLAST Bit Score: 121.0 Percent of Processed Sequence That Aligns: 43.98%
Query Start: 149 Query End: 266 Subject Start: 254753 Subject End: 254870 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 254753
Raw Sequence Start: 254604 PA0224 -
Extrapolated Insert Location: 254629 PA0224 -
Default Offset Location: 254667
H PA14 Blast Hit H PAO1 Blast Hit