Mutant Report for Mutant ID: 24241

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 8017
Chromat Path: H:\Pa14\MrT7\253v1\253v1_E01_E1_005.ab1 Last Transposon Base: 59 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGCCAGAGC
GACTACCGCACGCGCAACGAGGCCAGCGGCTTCCCCTTCAAGCTCGATGGCGACAGCCGCAGCCACCAGT
TCCGCGCCGAACGCGTGCTGCACCGCGACGGTGTGAGCAAGACCGCCATGAGCCTGGGGCTCAGCCACCA
GCGCACCAACAACTATGTCGAAGACACCCGCCTGGAAGACCAGAGCACGCGGATCACCGAGACCCAGCTC
GGCTTCAACCATGGCCGGCGGATCGGCAGTGGCTTCGTCAACCTCGACCTCGGCTGGCAGCAGGGCATCG
GCGCCCTTGGCGCGCAGGGTCGCGGCCACCCGCAGGCGGGCGATCCGAATGCGCGCTACGACAAGTACAG
CCTGACCCTCAGCTACCTGCAGCCGTTCCAGCTATGGGGCGAGCGCTTCTAATTCGACAGCCTGGCCACC
GGGCAGAGGAGCGAGGACGTGCTGTTCAGCCCGCAGCGCATCAGCCTCGGCGGCAACAGCTCGGTGCGCG
GCTTCAAGGACCAGACCCTGACCGGCGACAGCGGCGGCTACTGGCGCAACCAGTTGCGCTGGCGGCGTGC
GGTGGAATGGGCGCCGCTGCGGCCCTGGCTGCAGGAATACGGCGTGGCCTTCGCCTACGACTTCGGCGTG
ATCCGCCCCGACCGCTACAACGACTGCGCCAGGGGGCGCATGAACGGGCAACGCCATCTAAACTGGAAGC
CCGCGGTCCCTATTTCCCCCCCAGCGTCGGCTTTC
Blast against PA14
Processed Seqquence ID: 4320
5' Trim Position: 8 3' Trim Position: 597
Processed Sequence:
(Transposon Sequence in Red)
ATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGCCAGAGCGACTACCG
CACGCGCAACGAGGCCAGCGGCTTCCCCTTCAAGCTCGATGGCGACAGCCGCAGCCACCAGTTCCGCGCC
GAACGCGTGCTGCACCGCGACGGTGTGAGCAAGACCGCCATGAGCCTGGGGCTCAGCCACCAGCGCACCA
ACAACTATGTCGAAGACACCCGCCTGGAAGACCAGAGCACGCGGATCACCGAGACCCAGCTCGGCTTCAA
CCATGGCCGGCGGATCGGCAGTGGCTTCGTCAACCTCGACCTCGGCTGGCAGCAGGGCATCGGCGCCCTT
GGCGCGCAGGGTCGCGGCCACCCGCAGGCGGGCGATCCGAATGCGCGCTACGACAAGTACAGCCTGACCC
TCAGCTACCTGCAGCCGTTCCAGCTATGGGGCGAGCGCTTCTAATTCGACAGCCTGGCCACCGGGCAGAG
GAGCGAGGACGTGCTGTTCAGCCCGCAGCGCATCAGCCTCGGCGGCAACAGCTCGGTGCGCGGCTTCAAG
GACCAGACCCTGACCGGCGACAGCGGCGG
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
18511 18511 18512 18512 18513 18513 18514 18514
PA14 BLAST Hit ID: 18511       Show Transposon Map
Identities: 536/539 (99.44%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.34%
Query Start: 51 Query End: 589 Subject Start: 42000 Subject End: 42538 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 42000 PA14_00490,PA14_00500* +,+
Raw Sequence Start: 41942 PA14_00490,PA14_00500* +,+
Extrapolated Insert Location: 42001 PA14_00490,PA14_00500* +,+
Default Offset Location: 42005 PA14_00490,PA14_00500* +,+
PA14 BLAST Hit ID: 18512       Show Transposon Map
Identities: 532/539 (98.70%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.34%
Query Start: 51 Query End: 589 Subject Start: 2847634 Subject End: 2848172 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2847634 PA14_32780 +
Raw Sequence Start: 2847576 PA14_32780 +
Extrapolated Insert Location: 2847635 PA14_32780 +
Default Offset Location: 2847639 PA14_32780 +
PAO1 BLAST Hit ID: 18513       Show Transposon Map
Identities: 535/539 (99.25%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.34%
Query Start: 51 Query End: 589 Subject Start: 41980 Subject End: 42518 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 41980 PA0040 +
Raw Sequence Start: 41922 PA0040 +
Extrapolated Insert Location: 41981 PA0040 +
Default Offset Location: 41985 PA0040 +
PAO1 BLAST Hit ID: 18514       Show Transposon Map
Identities: 531/539 (98.51%) BLAST Bit Score: 999.9 Percent of Processed Sequence That Aligns: 91.34%
Query Start: 51 Query End: 589 Subject Start: 2779737 Subject End: 2779199 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2779737 PA2463 +
Raw Sequence Start: 2779795 PA2463 +
Extrapolated Insert Location: 2779736 PA2463 +
Default Offset Location: 2779732 PA2463 +
H PA14 Blast Hit H PAO1 Blast Hit