Mutant Report for Mutant ID: 24102

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 7878
Chromat Path: H:\Pa14\MrT7\252v1\252v1_A06_a_039.ab1 Last Transposon Base: 64 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCAG
CCTGTTCCTGCACTGGGGCAGCGCGCTGGTGGTCTTCGGCCTGTTCGGCCTGGGCCTGTGGATGCGCGAA
CTGAGCTATTACGACCCCTGATACCACCCCGCGCCATCATCTGCAGGCCTGGCCAGAATTCTTCTGCGGT
CTTGTCAACGTTTTTTTTTTTTTTGGTTTTTTTTTCGATTGGGTGTGTTAGATGACGTGTGTTTCATGTT
TTTTTGGGTATTCGGGTAACTGCGGATGTTTTGTTTTGCTTTTTATTTTTTGTTTTTTTTTTTGTTTTTT
TCTTTTTTTTGTCTGTTCTCTCCTCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGTGTTTTCGCCTCCTT
GCTTTGCTTTTTGTTTTTGTTGTCCGATTCTTGTTGGTTCTTGCCGGTGGGCAGTTTTTTTTTGTTTCTG
TTTTTTTTTTGTTGCTGTTGCTTATACTATATTTTTATGTTTTCTTTCATTGTTGTATCTAGTTGCTACT
TCGGTTGGTCTTTGTTCTTTTTTTTTGTTGCTTGGGGTGCTTTTTTTGTTCTTGTGTTGTTTCCCTATTT
TATATTTTTTCCTCCTTTTTTTATTTTTTTCTCCTTTTTTTTTTTTTTTTTTTTTTTGTATTCGCCTGCT
CTCTTTATCTTCTCCCTCGGGCTGGCTATCATTTTTTCCGTCTCCGTTTTTCCTTTATCCTCTTTCTGCT
TTCACTCCTTATTTGACCCGTTTCCCCCCTTTTTCTGTCCTCCGCCATCACTGTTTTTTGCATTTATCTA
TTATTGATTTGTCGCGGAGGCGTTTTGGTGTGGATTATGCCTATTCTCTCTCACTCTTTTTTTTACTGC
Blast against PA14
Processed Seqquence ID: 4188
5' Trim Position: 4 3' Trim Position: 201
Processed Sequence:
(Transposon Sequence in Red)
CAGTTTGTATACGACTCACTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTATTCAGCCTG
TTCCTGCACTGGGGCAGCGCGCTGGTGGTCTTCGGCCTGTTCGGCCTGGGCCTGTGGATGCGCGAACTGA
GCTATTACGACCCCTGATACCACCCCGCGCCATCATCTGCAGGCCTGGCCAGAATTC
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
17931 17931 17932 17932
PA14 BLAST Hit ID: 17931       Show Transposon Map
Identities: 111/112 (99.10%) BLAST Bit Score: 214.0 Percent of Processed Sequence That Aligns: 56.35%
Query Start: 60 Query End: 171 Subject Start: 484866 Subject End: 484977 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 484866 PA14_05500 +
Raw Sequence Start: 484803
Extrapolated Insert Location: 484867 PA14_05500 +
Default Offset Location: 484866 PA14_05500 +
PAO1 BLAST Hit ID: 17932       Show Transposon Map
Identities: 111/112 (99.10%) BLAST Bit Score: 214.0 Percent of Processed Sequence That Aligns: 56.35%
Query Start: 60 Query End: 171 Subject Start: 470115 Subject End: 470226 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 470115 PA0422 +
Raw Sequence Start: 470052
Extrapolated Insert Location: 470116 PA0422 +
Default Offset Location: 470115 PA0422 +
H PA14 Blast Hit H PAO1 Blast Hit