Mutant Report for Mutant ID: 23645

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 7421
Chromat Path: H:\Pa14\MrT7\247v1\247v1_C05_a_036.ab1 Last Transposon Base: 54 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
CGTTGAATCACTCCATTGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACATGACCCCCATCAT
CGTCCTCGGGACTTTCGGCATCCTCGCCGAGACCACCCAGGGACACGTCCCCGCCGCCTACATCGCCGCT
TCCCTGGCGATGCTCTTCACCGCCCTCAGCTACGGGCGCATGGCCGCGGCCTTCCCCGTGGCCGGCTCGG
CCTATACCTACGTGCGCAAGGCCATCGATTCCCGGCTCGGCTTCATCGCCGGCTGGGCGGTGCTGCTCGA
CTACCTGTTCCTGCCGATGGCGATCTGGCTGATCGGCGCCGCCTACCTGCACTCGGCCTTTCCCGCGGTA
CCCAACGCGGTCTGGGTGCTGGCGTTCATCGGCGTGACCACGACGATCAACATCATCTGCAANGGCCTGG
CCAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTNNTTTNTTTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTNTTTTTTTTTGGGTTTTNTNTTTTTTTTTTTTTTTTTTTGATTTTTTTTTTTTTNNTATAATTNT
ATAGTTNNTAAATTATNAAATAAATATCTTTTTTTTATTATTTTAAATAAT
Blast against PA14
Processed Seqquence ID: 3783
5' Trim Position: 15 3' Trim Position: 413
Processed Sequence:
(Transposon Sequence in Red)
TTGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACATGACCCCCATCATCGTCCTCGGGACTTT
CGGCATCCTCGCCGAGACCACCCAGGGACACGTCCCCGCCGCCTACATCGCCGCTTCCCTGGCGATGCTC
TTCACCGCCCTCAGCTACGGGCGCATGGCCGCGGCCTTCCCCGTGGCCGGCTCGGCCTATACCTACGTGC
GCAAGGCCATCGATTCCCGGCTCGGCTTCATCGCCGGCTGGGCGGTGCTGCTCGACTACCTGTTCCTGCC
GATGGCGATCTGGCTGATCGGCGCCGCCTACCTGCACTCGGCCTTTCCCGCGGTACCCAACGCGGTCTGG
GTGCTGGCGTTCATCGGCGTGACCACGACGATCAACATCATCTGCAAN
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
15751 15751 15752 15752 15753 15753 15754 15754 15755 15755 15756 15756 15757 15757 15758 15758 15759 15759 15760 15760 15761 15761
PA14 BLAST Hit ID: 15751       Show Transposon Map
Identities: 351/351 (100.00%) BLAST Bit Score: 696.0 Percent of Processed Sequence That Aligns: 87.94%
Query Start: 39 Query End: 389 Subject Start: 1524416 Subject End: 1524766 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 1524416 PA14_17740 +
Raw Sequence Start: 1524363 PA14_17740 +
Extrapolated Insert Location: 1524417 PA14_17740 +
Default Offset Location: 1524426 PA14_17740 +
PA14 BLAST Hit ID: 15752       Show Transposon Map
Identities: 50/53 (94.33%) BLAST Bit Score: 81.8 Percent of Processed Sequence That Aligns: 13.07%
Query Start: 232 Query End: 284 Subject Start: 376708 Subject End: 376656 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 376708 PA14_04200*,PA14_04210 -,+
Raw Sequence Start: 376954 PA14_04200*,PA14_04210 -,+
Extrapolated Insert Location: 376900 PA14_04200*,PA14_04210 -,+
Default Offset Location: 376891 PA14_04200*,PA14_04210 -,+
PA14 BLAST Hit ID: 15753       Show Transposon Map
Identities: 39/41 (95.12%) BLAST Bit Score: 65.9 Percent of Processed Sequence That Aligns: 10.05%
Query Start: 232 Query End: 272 Subject Start: 6475248 Subject End: 6475288 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6475248 PA14_72710 +
Raw Sequence Start: 6475002 PA14_72710 +
Extrapolated Insert Location: 6475056 PA14_72710 +
Default Offset Location: 6475065 PA14_72710 +
PA14 BLAST Hit ID: 15754       Show Transposon Map
Identities: 32/32 (100.00%) BLAST Bit Score: 63.9 Percent of Processed Sequence That Aligns: 7.79%
Query Start: 129 Query End: 160 Subject Start: 6475145 Subject End: 6475176 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6475145 PA14_72710 +
Raw Sequence Start: 6475002 PA14_72710 +
Extrapolated Insert Location: 6475056 PA14_72710 +
Default Offset Location: 6475065 PA14_72710 +
PA14 BLAST Hit ID: 15755       Show Transposon Map
Identities: 47/53 (88.67%) BLAST Bit Score: 58.0 Percent of Processed Sequence That Aligns: 13.07%
Query Start: 232 Query End: 284 Subject Start: 3401701 Subject End: 3401649 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3401701 PA14_38130,PA14_38120* +,+
Raw Sequence Start: 3401947 PA14_38130,PA14_38120* +,+
Extrapolated Insert Location: 3401893 PA14_38130,PA14_38120* +,+
Default Offset Location: 3401884 PA14_38130,PA14_38120* +,+
PAO1 BLAST Hit ID: 15756       Show Transposon Map
Identities: 351/351 (100.00%) BLAST Bit Score: 696.0 Percent of Processed Sequence That Aligns: 87.94%
Query Start: 39 Query End: 389 Subject Start: 4033592 Subject End: 4033242 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4033592 PA3597 +
Raw Sequence Start: 4033645 PA3597 +
Extrapolated Insert Location: 4033591 PA3597 +
Default Offset Location: 4033582 PA3597 +
PAO1 BLAST Hit ID: 15757       Show Transposon Map
Identities: 50/53 (94.33%) BLAST Bit Score: 81.8 Percent of Processed Sequence That Aligns: 13.07%
Query Start: 232 Query End: 284 Subject Start: 362538 Subject End: 362486 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 362538 PA0322 +
Raw Sequence Start: 362784 PA0322 +
Extrapolated Insert Location: 362730 PA0322 +
Default Offset Location: 362721 PA0322 +
PAO1 BLAST Hit ID: 15758       Show Transposon Map
Identities: 39/41 (95.12%) BLAST Bit Score: 65.9 Percent of Processed Sequence That Aligns: 10.05%
Query Start: 232 Query End: 272 Subject Start: 6202009 Subject End: 6202049 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6202009 PA5510 +
Raw Sequence Start: 6201763 PA5510 +
Extrapolated Insert Location: 6201817 PA5510 +
Default Offset Location: 6201826 PA5510 +
PAO1 BLAST Hit ID: 15759       Show Transposon Map
Identities: 32/32 (100.00%) BLAST Bit Score: 63.9 Percent of Processed Sequence That Aligns: 7.79%
Query Start: 129 Query End: 160 Subject Start: 6201906 Subject End: 6201937 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6201906 PA5510 +
Raw Sequence Start: 6201763 PA5510 +
Extrapolated Insert Location: 6201817 PA5510 +
Default Offset Location: 6201826 PA5510 +
PAO1 BLAST Hit ID: 15760       Show Transposon Map
Identities: 47/53 (88.67%) BLAST Bit Score: 58.0 Percent of Processed Sequence That Aligns: 13.07%
Query Start: 232 Query End: 284 Subject Start: 2232499 Subject End: 2232551 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 2232499 PA2041 +
Raw Sequence Start: 2232253 PA2041 +
Extrapolated Insert Location: 2232307 PA2041 +
Default Offset Location: 2232316 PA2041 +
PAO1 BLAST Hit ID: 15761       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 4.77%
Query Start: 350 Query End: 369 Subject Start: 3619304 Subject End: 3619285 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 3619304 PA3232 +
Raw Sequence Start: 3619668 PA3233 +
Extrapolated Insert Location: 3619614 PA3232 +
Default Offset Location: 3619605 PA3232 +
H PA14 Blast Hit H PAO1 Blast Hit