Mutant Report for Mutant ID: 23634

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 7410
Chromat Path: H:\Pa14\MrT7\247v1\247v1_B06_a_047.ab1 Last Transposon Base: 112 Transposon Sequence
Match Quality: 1
Raw Sequence:
(Transposon Sequence in Red)
TTTTTTTTTTTTTTTTTTTTTTTTGTTTTTTTGTGTTTTGTGNCCCCCCNTTGTTCGTTGTAATACGACT
CCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCACCTGTTATCCTACCGCTTGCCGCTCCGCCGAACG
CCGCCCGGCGGCTCCGACTACGCCCTGGCCCTGCTGCTCGCCCTCGGCGGTGCGTTGCCGGCCAGTGCCG
CCGATGCTCCCGCGCCCGCCGAGGAGGCGCCGCCGCTGGCCGGCAGCGCACCGGCCAAGGCCGATACGGC
CCTGGGCCAGGTTACCGTCACCGCGCGTCGCCGCTAGGAGGATTCACAGAAGGTACCGACTCCGATCACC
GTGCTCGGTGGCGAGACTCTCGTGGTCCCGCACATCTCCCGGGTGCTGGACTTGCACTTTAGCCGCCCAT
CTTCTTTGTCTTCTTCTTCCTTGTTCGTTCCCTTTTATCGTCCCTTTTTTGTTATCTATAATATCTTCTC
CATGAAATACTGCAAAAGAATACCGAATTCTTCCTCCGCGCTATAACATTATATACCAGAATTTGTAAAA
AAAATAAATACATACAAACCAAAAACTTTAAATATACAATATAATCACCGTCACACCTTCCTCCTAATAC
AACCTCTCTCCCTCCCCTGTTTCATCTTTTTAATATTTTCTTATCCAAACTCACCCTCTAGATTTTTTGA
CTGCGGTTACTTGAGTAGTGCCCGCAAGGTGACACCGTACTCTTTCAATCACGTTTACCACTATAATATA
TCCTCTCAGAGACCCTCGATAAAAATTAATAACACCATACACACATACATATATATAAAAGTAAAAAAAG
ACACACAGACTTCTCAAAGAGTTATTATATTTTGAATATAGATTTTGGTACACCCAATCTATATACTTTA
ATAAGATTTAACATCTAGTGTTTAGTAACGTATTACTAAAGTAAAATGCATACACATTTCN
Blast against PA14
Processed Seqquence ID: 3775
5' Trim Position: 68 3' Trim Position: 260
Processed Sequence:
(Transposon Sequence in Red)
CTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCACCTGTTATCCTACCGCTTGCCGCTCCGCCGAA
CGCCGCCCGGCGGCTCCGACTACGCCCTGGCCCTGCTGCTCGCCCTCGGCGGTGCGTTGCCGGCCAGTGC
CGCCGATGCTCCCGCGCCCGCCGAGGAGGCGCCGCCGCTGGCCGGCAGCGCA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
15694 15694 15695 15695 15696 15696 15697 15697
PA14 BLAST Hit ID: 15694       Show Transposon Map
Identities: 145/145 (100.00%) BLAST Bit Score: 287.0 Percent of Processed Sequence That Aligns: 75.00%
Query Start: 48 Query End: 192 Subject Start: 215919 Subject End: 216063 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 215919 PA14_02400*,PA14_02410 -,+
Raw Sequence Start: 215804 PA14_02400* -
Extrapolated Insert Location: 215916 PA14_02400*,PA14_02410 -,+
Default Offset Location: 215867 PA14_02400* -
PA14 BLAST Hit ID: 15695       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 9.90%
Query Start: 97 Query End: 116 Subject Start: 805128 Subject End: 805147 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 805128 PA14_09380 +
Raw Sequence Start: 804964 PA14_09380 +
Extrapolated Insert Location: 805076 PA14_09380 +
Default Offset Location: 805027 PA14_09380 +
PAO1 BLAST Hit ID: 15696       Show Transposon Map
Identities: 143/145 (98.62%) BLAST Bit Score: 272.0 Percent of Processed Sequence That Aligns: 75.00%
Query Start: 48 Query End: 192 Subject Start: 219183 Subject End: 219327 Tn Insert Strand: +
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 219183 PA0192 +
Raw Sequence Start: 219068
Extrapolated Insert Location: 219180 PA0192 +
Default Offset Location: 219131
PAO1 BLAST Hit ID: 15697       Show Transposon Map
Identities: 20/20 (100.00%) BLAST Bit Score: 40.1 Percent of Processed Sequence That Aligns: 9.90%
Query Start: 97 Query End: 116 Subject Start: 4721690 Subject End: 4721671 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 4721690 PA4218 +
Raw Sequence Start: 4721854 PA4218 +
Extrapolated Insert Location: 4721742 PA4218 +
Default Offset Location: 4721791 PA4218 +
H PA14 Blast Hit H PAO1 Blast Hit