Mutant Report for Mutant ID: 23110

Strain: PA14 Genetic Background: Wild Type Transposon: MrT7 Library: lib_09_03
Raw Sequence ID: 6886
Chromat Path: H:\Pa14\MrT7\241v1\241v1_F10_a_089.ab1 Last Transposon Base: 63 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTTCAGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGCCCA
CTACCTGCGCAACCTCGGCTATCGCACGGCGCTGTCGGGCAAGATGCACTTCTGCGGTCCCGACCAGTTG
CACGGCTACGAGGAACGCCTGACCAGCGACATCTATCCGGCGGACTATGGCTGGGCGGTGAACTGGGACG
AGCCGGAGGTGCGCCCGAGCTGGTACCACAACATGTCCTCGGTTTTGCAGGCCGGTCCCTGCGTGCGCAC
CAACCAGCTGGACTTCGACGAGGAGGTGGTGTTCAAGGCCCGCCAGTACCTCTACGACCATGTTCGCCAG
CACGCCGGCCAGCCATTCTGCCTGACCGTGTCGATGACCCATACGCACGACCCCTATCGTCTGCCGNGCC
TAGCTCATGGAATCTCTACCGCGACGAGGACATCCCGCTGCCGCGCCAGCGCTTCTCCCAGGAGGAGCAG
GACCCTCATTCGCAACGCCTGCTGAAGGTCATCGACCTGTGGGACAAGCCGTTGCCCGAGGAGCGCATCC
GCCCCGCCCGGCGTGCCTACTTCGGCGCCTGCAGCTACCTCGACCCGCAGATCGGTGCGCTGCTGGCCGA
CCCTGGAGGAATGCCGGCTGGCCGACGACACCTCGTGGTGTTCTCCGGCGACCATGGCGACCTGCTCGGC
GAGCGCGGCCTCTGGTACAAGATGCCCTGGTTCGAGATGGCCGCGCGCGTGCCGCTCCTGGTCCACTGCC
CCGGGCCGCTTCCCGCCGCGCCCCAACGGCGCTTCGGTATCCCCCGTGGACCTGCTGCCAACCCTGGGG
Blast against PA14
Processed Seqquence ID: 3366
5' Trim Position: 14 3' Trim Position: 558
Processed Sequence:
(Transposon Sequence in Red)
ACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACGCCCACTACCTGCGCAACC
TCGGCTATCGCACGGCGCTGTCGGGCAAGATGCACTTCTGCGGTCCCGACCAGTTGCACGGCTACGAGGA
ACGCCTGACCAGCGACATCTATCCGGCGGACTATGGCTGGGCGGTGAACTGGGACGAGCCGGAGGTGCGC
CCGAGCTGGTACCACAACATGTCCTCGGTTTTGCAGGCCGGTCCCTGCGTGCGCACCAACCAGCTGGACT
TCGACGAGGAGGTGGTGTTCAAGGCCCGCCAGTACCTCTACGACCATGTTCGCCAGCACGCCGGCCAGCC
ATTCTGCCTGACCGTGTCGATGACCCATACGCACGACCCCTATCGTCTGCCGNGCCTAGCTCATGGAATC
TCTACCGCGACGAGGACATCCCGCTGCCGCGCCAGCGCTTCTCCCAGGAGGAGCAGGACCCTCATTCGCA
ACGCCTGCTGAAGGTCATCGACCTGTGGGACAAGCCGTTGCCCGAGGAGCGCAT
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
13921 13921 13922 13922
PA14 BLAST Hit ID: 13921       Show Transposon Map
Identities: 483/496 (97.37%) BLAST Bit Score: 876.0 Percent of Processed Sequence That Aligns: 90.99%
Query Start: 49 Query End: 544 Subject Start: 34277 Subject End: 33784 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 34277 PA14_00370*,PA14_00380,PA14_00390* -,+,+
Raw Sequence Start: 34339 PA14_00370*,PA14_00380,PA14_00390* -,+,+
Extrapolated Insert Location: 34276 PA14_00370*,PA14_00380,PA14_00390* -,+,+
Default Offset Location: 34276 PA14_00370*,PA14_00380,PA14_00390* -,+,+
PAO1 BLAST Hit ID: 13922       Show Transposon Map
Identities: 483/496 (97.37%) BLAST Bit Score: 876.0 Percent of Processed Sequence That Aligns: 90.99%
Query Start: 49 Query End: 544 Subject Start: 34256 Subject End: 33763 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 34256 PA0031 +
Raw Sequence Start: 34318 PA0031 +
Extrapolated Insert Location: 34255 PA0031 +
Default Offset Location: 34255 PA0031 +
H PA14 Blast Hit H PAO1 Blast Hit