Mutant Report for Mutant ID: 22331

Strain: PA14 Genetic Background: eUsU Transposon: MrT7 Library: 06_03
Raw Sequence ID: 6107
Chromat Path: I:\eUsU\MrT7\233v1\233v1_E11_a_085.ab1 Last Transposon Base: 61 Transposon Sequence
Match Quality: 0
Raw Sequence:
(Transposon Sequence in Red)
TGTCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGCCAGG
GGATGCCGACCCGGTCGCCTTCCTTCACCCGGGTCACTCCGCTGCCCACCGCGGCGACGTAGCCGACGCC
TTCGTGACCGGGAATGAACGGCAACGGCGGCTTCACCGGCCAGTCGCCCTCGGCGGCGTGCAGGTCGGTG
TGGCAGACGCCGGAGGCTTCGATCTTCACCAGTACCTGCCCGGGGCCGGGCAGCGGAACCTTGACTTCCT
CGATCCGCAGCGGCGCGCCGTAGGCGTGCACGACCGCGGCTTTCATGGTCTGTGGCAGGGTCATGGTCAT
CTCCTTGGACGGGGCTGAGCGCNCCTGTCGCGGTGCCTTTGACGGGCACCGCGACAGGCTGCGGAACCGG
CGCGGCCGCCGCTCCCTCGGAGCGCGCCGCGACAACCAGTCTGGCCGCTCGTGGCAGGCGCGCATTGAGT
TGCGGCAAGTTTCCCGCCATGGCGCGAAAAAACGGGACGGACGGTAGCCCCCGGCGCGCGCCCGGCCTGC
CTTTGCGGTATACTGGCCCCCGTGTACTAGTCGAACGCGTGGCCAATATATGCATACCACGAGCCGCGCT
CGGCTCCATGAAGGTTCGCTTTCTGGTCTCCTTTGCCCGCTTTCGTATGTTTTCTTTTTTGGCCTTTTCT
TTATTTTCCTCTTTTCTTATTTTTTCTTCTTTGTTTTTTACGTTATGTATTTGTTTCCTCTTCTCCCCCC
TCGGTGGTTTCTTTCGTGCCGCCTTGACTACCCCCTTATTCACTTTTAGCGGGGTTTTTGGCGCTCCTCT
TGCCTTCTCTTGCTTGTTAGCGTCATTGTTTTGGTTTCTTC
Blast against PA14
Processed Seqquence ID: 3019
5' Trim Position: 1 3' Trim Position: 572
Processed Sequence:
(Transposon Sequence in Red)
GTCGTTTGTATACGACTCCTATAGGGGTCTAGAGACCGGGGACTTATCAGCCAACCTGTTACAGCCAGGG
GATGCCGACCCGGTCGCCTTCCTTCACCCGGGTCACTCCGCTGCCCACCGCGGCGACGTAGCCGACGCCT
TCGTGACCGGGAATGAACGGCAACGGCGGCTTCACCGGCCAGTCGCCCTCGGCGGCGTGCAGGTCGGTGT
GGCAGACGCCGGAGGCTTCGATCTTCACCAGTACCTGCCCGGGGCCGGGCAGCGGAACCTTGACTTCCTC
GATCCGCAGCGGCGCGCCGTAGGCGTGCACGACCGCGGCTTTCATGGTCTGTGGCAGGGTCATGGTCATC
TCCTTGGACGGGGCTGAGCGCNCCTGTCGCGGTGCCTTTGACGGGCACCGCGACAGGCTGCGGAACCGGC
GCGGCCGCCGCTCCCTCGGAGCGCGCCGCGACAACCAGTCTGGCCGCTCGTGGCAGGCGCGCATTGAGTT
GCGGCAAGTTTCCCGCCATGGCGCGAAAAAACGGGACGGACGGTAGCCCCCGGCGCGCGCCCGGCCTGCC
TTTGCGGTATA
Blast against PA14
BLAST of Processed Sequence against PA14 And PAO1 Genome Sequence
12288 12288 12289 12289
PA14 BLAST Hit ID: 12288       Show Transposon Map
Identities: 510/512 (99.60%) BLAST Bit Score: 993.0 Percent of Processed Sequence That Aligns: 89.49%
Query Start: 60 Query End: 571 Subject Start: 6380317 Subject End: 6379808 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6380317 PA14_71630 -
Raw Sequence Start: 6380377 PA14_71630 -
Extrapolated Insert Location: 6380316 PA14_71630 -
Default Offset Location: 6380314 PA14_71630 -
PAO1 BLAST Hit ID: 12289       Show Transposon Map
Identities: 506/512 (98.82%) BLAST Bit Score: 961.0 Percent of Processed Sequence That Aligns: 89.49%
Query Start: 60 Query End: 571 Subject Start: 6107393 Subject End: 6106884 Tn Insert Strand: -
Location Name Genome Location ORF(*=unsupported) ORF Orientation Relative to Query Sequence
Subject Start: 6107393 PA5427 -
Raw Sequence Start: 6107453 PA5427 -
Extrapolated Insert Location: 6107392 PA5427 -
Default Offset Location: 6107390 PA5427 -
H PA14 Blast Hit H PAO1 Blast Hit