BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= (957 letters)

Distribution of 24 Blast Hits on the Query Sequence




                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                           285   5e-77 
>GCTS_68 
          Length = 6534396

 Score =  285 bits (144), Expect = 5e-77
 Identities = 259/296 (87%), Gaps = 1/296 (0%)
 Strand = Plus / Minus

                                                                           
Query: 130     taggcatcgaacaactggttggcggggacgtcgctcatcggttttccttttcccggcccg 189
               |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 6051313 taggcatcgaacaactggttggcgggtacgtcgctcatcggttttccttttcccggcccg 6051254

                                                                           
Query: 190     tcagggctcgtcgttcaggtagctgaccttgcgcagatccggcaggctcacgcaaaccat 249
               |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| 
Sbjct: 6051253 tcagggctcgtcgttcaggtagctgaccttgcgcagatccggcaggctcacgcagaccag 6051194

                                                                           
Query: 250     cagcttgagaaggggcaaggctgatacataccagcagaagacgttctccatccctcccga 309
               ||||   || |||  || |||||| ||||||||| |||||||||||||||||||| ||||
Sbjct: 6051193 cagcgccagcaggcacatggctgaaacataccagtagaagacgttctccatccctaccga 6051134

                                                                           
Query: 310     cttcatccacagggcgaatttctaggccgagccttcaaataccgcgttgcccactgtgta 369
               ||||| || ||||||||  | || |||||||||  | || | |||||||||||| | |||
Sbjct: 6051133 cttcagccccagggcgacgtactcggccgagccgccgaagatcgcgttgcccaccgcgta 6051074

                                                                       
Query: 370     ggacactttctacgccgattgcgcgctgttccggtggtaacttctcggccttgatc 425
               |||||| | | |||||||  ||||||   ||||| || ||| ||||||||||||||
Sbjct: 6051073 ggacac-tccgacgccgagggcgcgcacctccggcgggaacatctcggccttgatc 6051019

 Score = 40.1 bits (20), Expect = 0.005
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 134     catcgaacaactggttggcg 153
               ||||||||||||||||||||
Sbjct: 2871933 catcgaacaactggttggcg 2871914

 Score = 36.2 bits (18), Expect = 0.079
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 137     cgaacaactggttggcgg 154
               ||||||||||||||||||
Sbjct: 5082765 cgaacaactggttggcgg 5082782

 Score = 34.2 bits (17), Expect = 0.31
 Identities = 20/21 (95%)
 Strand = Plus / Plus

                                    
Query: 410     cttctcggccttgatctcgtc 430
               ||||||||||||| |||||||
Sbjct: 1372747 cttctcggccttgctctcgtc 1372767

 Score = 34.2 bits (17), Expect = 0.31
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 494     atacgtattgctcactg 510
               |||||||||||||||||
Sbjct: 2924177 atacgtattgctcactg 2924161

 Score = 34.2 bits (17), Expect = 0.31
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 657     cggcgtgccaggttttt 673
               |||||||||||||||||
Sbjct: 4667077 cggcgtgccaggttttt 4667061

 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                              
Query: 196    ctcgtcgttcaggtag 211
              ||||||||||||||||
Sbjct: 124175 ctcgtcgttcaggtag 124190

 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 415     cggccttgatctcgtc 430
               ||||||||||||||||
Sbjct: 3101462 cggccttgatctcgtc 3101477

 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 566     aaaatattatttattt 581
               ||||||||||||||||
Sbjct: 3836364 aaaatattatttattt 3836349

 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 564     ccaaaatattatttat 579
               ||||||||||||||||
Sbjct: 3846620 ccaaaatattatttat 3846605

 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 194     ggctcgtcgttcaggt 209
               ||||||||||||||||
Sbjct: 4780805 ggctcgtcgttcaggt 4780790

 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 131     aggcatcgaacaactg 146
               ||||||||||||||||
Sbjct: 5079105 aggcatcgaacaactg 5079120

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 658    ggcgtgccaggtttt 672
              |||||||||||||||
Sbjct: 971218 ggcgtgccaggtttt 971204

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 220     gcgcagatccggcaggctc 238
               |||||| ||||||||||||
Sbjct: 1257638 gcgcaggtccggcaggctc 1257620

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 682     cgttgctgatgatga 696
               |||||||||||||||
Sbjct: 1563365 cgttgctgatgatga 1563351

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 414     tcggccttgatctcg 428
               |||||||||||||||
Sbjct: 2437715 tcggccttgatctcg 2437701

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 686     gctgatgatgaccat 700
               |||||||||||||||
Sbjct: 2865821 gctgatgatgaccat 2865835

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 389     tgcgcgctgttccgg 403
               |||||||||||||||
Sbjct: 3662873 tgcgcgctgttccgg 3662887

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 616     ttgcggcatcagcttgctc 634
               |||||| ||||||||||||
Sbjct: 3753635 ttgcgggatcagcttgctc 3753617

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 382     cgccgattgcgcgctgttc 400
               ||||||| |||||||||||
Sbjct: 4507500 cgccgatggcgcgctgttc 4507482

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 197     tcgtcgttcaggtag 211
               |||||||||||||||
Sbjct: 4851208 tcgtcgttcaggtag 4851194

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 618     gcggcatcagcttgc 632
               |||||||||||||||
Sbjct: 5634009 gcggcatcagcttgc 5633995

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 654     ccccggcgtgccagg 668
               |||||||||||||||
Sbjct: 5713631 ccccggcgtgccagg 5713645

 Score = 30.2 bits (15), Expect = 4.9
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 416     ggccttgatctcgtc 430
               |||||||||||||||
Sbjct: 6381740 ggccttgatctcgtc 6381726
  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2542
Number of Sequences: 1
Number of extensions: 2542
Number of successful extensions: 26
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 24
length of query: 957
length of database: 6,534,396
effective HSP length: 16
effective length of query: 941
effective length of database: 6,534,380
effective search space: 6148851580
effective search space used: 6148851580
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)