BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= 
         (909 letters)

Distribution of 44 Blast Hits on the Query Sequence 



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                           214   1e-55 



>GCTS_68 
          Length = 6534396

 Score =  214 bits (108), Expect = 1e-55
 Identities = 111/112 (99%)
 Strand = Plus / Plus

                                                                           
Query: 64      tattcagcctgttcctgcactggggcagcgcgctggtggtcttcggcctgttcggcctgg 123
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6286208 tattcagcctgttcctgcactggggcagcgcgctggtggtcttcggcctgttcggcctgg 6286267

                                                                   
Query: 124     gcctgtggatgcgcgaactgagctattacgacccctgataccaccccgcgcc 175
               ||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 6286268 gcctgtggatgcgcgaactgagctattacgacccctggtaccaccccgcgcc 6286319






 Score = 38.2 bits (19), Expect = 0.019
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                         
Query: 103    tcttcggcctgttcggcctgggcctgt 129
              |||||||||||||| |||||| |||||
Sbjct: 105990 tcttcggcctgttcagcctggccctgt 105964






 Score = 38.2 bits (19), Expect = 0.019
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 107     cggcctgttcggcctgggc 125
               |||||||||||||||||||
Sbjct: 3872433 cggcctgttcggcctgggc 3872451






 Score = 36.2 bits (18), Expect = 0.075
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                     
Query: 107     cggcctgttcggcctgggcctg 128
               ||||||||||||||||| ||||
Sbjct: 2605885 cggcctgttcggcctggacctg 2605906






 Score = 36.2 bits (18), Expect = 0.075
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 104     cttcggcctgttcggcct 121
               ||||||||||||||||||
Sbjct: 2905665 cttcggcctgttcggcct 2905682






 Score = 36.2 bits (18), Expect = 0.075
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 72      ctgttcctgcactggggc 89
               ||||||||||||||||||
Sbjct: 3838983 ctgttcctgcactggggc 3839000






 Score = 34.2 bits (17), Expect = 0.30
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 94      cgctggtggtcttcggc 110
               |||||||||||||||||
Sbjct: 4975292 cgctggtggtcttcggc 4975308






 Score = 34.2 bits (17), Expect = 0.30
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                    
Query: 103     tcttcggcctgttcggcctgg 123
               |||||||||||||| ||||||
Sbjct: 6057144 tcttcggcctgttcagcctgg 6057124






 Score = 34.2 bits (17), Expect = 0.30
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 106     tcggcctgttcggcctg 122
               |||||||||||||||||
Sbjct: 6184616 tcggcctgttcggcctg 6184600






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                              
Query: 83     ctggggcagcgcgctg 98
              ||||||||||||||||
Sbjct: 432499 ctggggcagcgcgctg 432514






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                  
Query: 106    tcggcctgttcggcctgggc 125
              ||||| ||||||||||||||
Sbjct: 458035 tcggcatgttcggcctgggc 458054






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 115     tcggcctgggcctgtg 130
               ||||||||||||||||
Sbjct: 1725196 tcggcctgggcctgtg 1725181






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 108     ggcctgttcggcctgg 123
               ||||||||||||||||
Sbjct: 2492859 ggcctgttcggcctgg 2492874






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 95      gctggtggtcttcggc 110
               ||||||||||||||||
Sbjct: 2735186 gctggtggtcttcggc 2735171






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                   
Query: 104     cttcggcctgttcggcctgg 123
               ||||| ||||||||||||||
Sbjct: 3068238 cttcgccctgttcggcctgg 3068257






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 113     gttcggcctgggcctg 128
               ||||||||||||||||
Sbjct: 3783057 gttcggcctgggcctg 3783042






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 22/24 (91%)
 Strand = Plus / Minus

                                       
Query: 102     gtcttcggcctgttcggcctgggc 125
               |||| |||| ||||||||||||||
Sbjct: 5571261 gtctacggcgtgttcggcctgggc 5571238






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 93      gcgctggtggtcttcg 108
               ||||||||||||||||
Sbjct: 5957095 gcgctggtggtcttcg 5957110






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 109     gcctgttcggcctggg 124
               ||||||||||||||||
Sbjct: 6086522 gcctgttcggcctggg 6086507






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 93      gcgctggtggtcttcg 108
               ||||||||||||||||
Sbjct: 6286624 gcgctggtggtcttcg 6286639






 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 107     cggcctgttcggcctg 122
               ||||||||||||||||
Sbjct: 6432331 cggcctgttcggcctg 6432316






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                            
Query: 68    cagcctgttcctgca 82
             |||||||||||||||
Sbjct: 26741 cagcctgttcctgca 26755






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 86     gggcagcgcgctggt 100
              |||||||||||||||
Sbjct: 252834 gggcagcgcgctggt 252820






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 111    ctgttcggcctgggc 125
              |||||||||||||||
Sbjct: 406731 ctgttcggcctgggc 406745






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 108     ggcctgttcggcctg 122
               |||||||||||||||
Sbjct: 1085154 ggcctgttcggcctg 1085168






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 114     ttcggcctgggcctg 128
               |||||||||||||||
Sbjct: 1269790 ttcggcctgggcctg 1269776






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 107     cggcctgttcggcctgggc 125
               ||||||| |||||||||||
Sbjct: 2302375 cggcctgctcggcctgggc 2302357






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 96      ctggtggtcttcggcctgt 114
               |||||| ||||||||||||
Sbjct: 2320166 ctggtgttcttcggcctgt 2320184






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 107     cggcctgttcggcctgggc 125
               ||||||| |||||||||||
Sbjct: 3011475 cggcctggtcggcctgggc 3011457






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 95      gctggtggtcttcggcctg 113
               ||||||||||| |||||||
Sbjct: 3152323 gctggtggtctacggcctg 3152341






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 105     ttcggcctgttcggc 119
               |||||||||||||||
Sbjct: 3284848 ttcggcctgttcggc 3284862






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 308     gttttgttttgctttttat 326
               ||||||||||||| |||||
Sbjct: 3723360 gttttgttttgctgtttat 3723342






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 92      cgcgctggtggtcttcggc 110
               |||||||||||||| ||||
Sbjct: 3789225 cgcgctggtggtctgcggc 3789243






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 107     cggcctgttcggcct 121
               |||||||||||||||
Sbjct: 3850070 cggcctgttcggcct 3850056






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 21/23 (91%)
 Strand = Plus / Plus

                                      
Query: 102     gtcttcggcctgttcggcctggg 124
               ||||||| | |||||||||||||
Sbjct: 4409884 gtcttcgtcgtgttcggcctggg 4409906






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 109     gcctgttcggcctgg 123
               |||||||||||||||
Sbjct: 4442983 gcctgttcggcctgg 4442997






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 183     gcaggcctggccaga 197
               |||||||||||||||
Sbjct: 4545339 gcaggcctggccaga 4545325






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 429     ttttgtttttgttgt 443
               |||||||||||||||
Sbjct: 4844272 ttttgtttttgttgt 4844258






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 111     ctgttcggcctgggc 125
               |||||||||||||||
Sbjct: 5272820 ctgttcggcctgggc 5272806






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 336     ttttttttgtttttt 350
               |||||||||||||||
Sbjct: 5334362 ttttttttgtttttt 5334348






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 108     ggcctgttcggcctg 122
               |||||||||||||||
Sbjct: 5496916 ggcctgttcggcctg 5496930






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 102     gtcttcggcctgttc 116
               |||||||||||||||
Sbjct: 5884285 gtcttcggcctgttc 5884271






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 713     tccctcgggctggctatca 731
               |||||||||||||| ||||
Sbjct: 6376551 tccctcgggctggccatca 6376569






 Score = 30.2 bits (15), Expect = 4.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 91      gcgcgctggtggtct 105
               |||||||||||||||
Sbjct: 6382551 gcgcgctggtggtct 6382537






  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3686
Number of Sequences: 1
Number of extensions: 3686
Number of successful extensions: 44
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 44
length of query: 909
length of database: 6,534,396
effective HSP length: 16
effective length of query: 893
effective length of database: 6,534,380
effective search space: 5835201340
effective search space used: 5835201340
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)