BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= 
         (1034 letters)

Distribution of 30 Blast Hits on the Query Sequence 



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                           396   e-110 



>GCTS_68 
          Length = 6534396

 Score =  396 bits (200), Expect = e-110
 Identities = 224/232 (96%)
 Strand = Plus / Minus

                                                                           
Query: 68      atggggctatgcatgatcacctccttgatctcgtcgcgtgtcagcccgttcatcttcgcc 127
               |||| ||| ||||||||||| |||||||||||||||||  ||| ||||||  ||||||||
Sbjct: 6053779 atggcgctctgcatgatcacttccttgatctcgtcgcggctcaccccgttgttcttcgcc 6053720

                                                                           
Query: 128     gcgctcagatgcagcttgagttcctcgttgcggttcatgccgatcagcatggcgatggtg 187
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6053719 gcgctcagatgcagcttgagttcctcgttgcggttcatgccgatcagcatggcgatggtg 6053660

                                                                           
Query: 188     accaggctgcgggtgtgtcgcggcagccccggacgggtccagatgtcgccccaggcgtgg 247
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6053659 accaggctgcgggtgtgtcgcggcagccccggacgggtccagatgtcgccccaggcgtgg 6053600

                                                                   
Query: 248     cgggtgatcatctcctggaactcttcgttgaacggcgtcaggttggccaggc 299
               ||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6053599 cgggtgatcatctcctggaactcttcgttgaacggcgtcaggttggccaggc 6053548






 Score = 38.2 bits (19), Expect = 0.022
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 146     agttcctcgttgcggttca 164
               |||||||||||||||||||
Sbjct: 2560481 agttcctcgttgcggttca 2560499






 Score = 36.2 bits (18), Expect = 0.086
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                    
Query: 114    cgttcatcttcgccgcgctcag 135
              ||||||||| ||||||||||||
Sbjct: 107808 cgttcatctgcgccgcgctcag 107829






 Score = 34.2 bits (17), Expect = 0.34
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                               
Query: 179    gcgatggtgaccaggct 195
              |||||||||||||||||
Sbjct: 998188 gcgatggtgaccaggct 998204






 Score = 34.2 bits (17), Expect = 0.34
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 89      tccttgatctcgtcgcg 105
               |||||||||||||||||
Sbjct: 1593303 tccttgatctcgtcgcg 1593287






 Score = 32.2 bits (16), Expect = 1.3
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                   
Query: 165     tgccgatcagcatggcgatg 184
               |||||||||||| |||||||
Sbjct: 1161177 tgccgatcagcagggcgatg 1161196






 Score = 32.2 bits (16), Expect = 1.3
 Identities = 22/24 (91%)
 Strand = Plus / Minus

                                       
Query: 161     ttcatgccgatcagcatggcgatg 184
               |||||||||||||||  |||||||
Sbjct: 1593342 ttcatgccgatcagcgcggcgatg 1593319






 Score = 32.2 bits (16), Expect = 1.3
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 165     tgccgatcagcatggc 180
               ||||||||||||||||
Sbjct: 3010905 tgccgatcagcatggc 3010890






 Score = 32.2 bits (16), Expect = 1.3
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 90      ccttgatctcgtcgcg 105
               ||||||||||||||||
Sbjct: 3101465 ccttgatctcgtcgcg 3101480






 Score = 32.2 bits (16), Expect = 1.3
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 287     aggttggccaggccct 302
               ||||||||||||||||
Sbjct: 4042721 aggttggccaggccct 4042706






 Score = 32.2 bits (16), Expect = 1.3
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 166     gccgatcagcatggcg 181
               ||||||||||||||||
Sbjct: 4460049 gccgatcagcatggcg 4460034






 Score = 32.2 bits (16), Expect = 1.3
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 286     caggttggccaggccc 301
               ||||||||||||||||
Sbjct: 5147909 caggttggccaggccc 5147924






 Score = 32.2 bits (16), Expect = 1.3
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 141     gcttgagttcctcgtt 156
               ||||||||||||||||
Sbjct: 5882802 gcttgagttcctcgtt 5882817






 Score = 32.2 bits (16), Expect = 1.3
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 168     cgatcagcatggcgat 183
               ||||||||||||||||
Sbjct: 6488808 cgatcagcatggcgat 6488793






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                 
Query: 174    gcatggcgatggtgaccag 192
              ||||||||||| |||||||
Sbjct: 517541 gcatggcgatgttgaccag 517559






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                 
Query: 163    catgccgatcagcatggcg 181
              |||||||||||||| ||||
Sbjct: 934544 catgccgatcagcacggcg 934562






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 229     gatgtcgccccaggc 243
               |||||||||||||||
Sbjct: 1003855 gatgtcgccccaggc 1003869






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 107     gtcagcccgttcatc 121
               |||||||||||||||
Sbjct: 1467341 gtcagcccgttcatc 1467327






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 163     catgccgatcagcat 177
               |||||||||||||||
Sbjct: 1635747 catgccgatcagcat 1635761






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 159     ggttcatgccgatca 173
               |||||||||||||||
Sbjct: 2837917 ggttcatgccgatca 2837903






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 201     tgtgtcgcggcagcc 215
               |||||||||||||||
Sbjct: 2998104 tgtgtcgcggcagcc 2998090






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 175     catggcgatggtgac 189
               |||||||||||||||
Sbjct: 3467537 catggcgatggtgac 3467551






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 166     gccgatcagcatggc 180
               |||||||||||||||
Sbjct: 3614039 gccgatcagcatggc 3614053






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 21/23 (91%)
 Strand = Plus / Plus

                                      
Query: 995     cttcgcttcgatatgttcgtcca 1017
               |||||| ||| ||||||||||||
Sbjct: 4017298 cttcgcctcggtatgttcgtcca 4017320






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 23      ggcatcatctgctgg 37
               |||||||||||||||
Sbjct: 4347757 ggcatcatctgctgg 4347771






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 178     ggcgatggtgaccag 192
               |||||||||||||||
Sbjct: 4751253 ggcgatggtgaccag 4751239






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 87      cctccttgatctcgtcgcg 105
               |||| ||||||||||||||
Sbjct: 5167704 cctcgttgatctcgtcgcg 5167722






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 290     ttggccaggcccttc 304
               |||||||||||||||
Sbjct: 5380434 ttggccaggcccttc 5380448






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 286     caggttggccaggcccttc 304
               |||| ||||||||||||||
Sbjct: 6117953 caggatggccaggcccttc 6117935






 Score = 30.2 bits (15), Expect = 5.3
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 165     tgccgatcagcatggcgat 183
               |||||||||||| ||||||
Sbjct: 6173894 tgccgatcagcacggcgat 6173876






  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4151
Number of Sequences: 1
Number of extensions: 4151
Number of successful extensions: 30
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 30
length of query: 1034
length of database: 6,534,396
effective HSP length: 17
effective length of query: 1017
effective length of database: 6,534,379
effective search space: 6645463443
effective search space used: 6645463443
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)