BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= (933 letters)

Distribution of 5 Blast Hits on the Query Sequence




                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                           188   9e-48 
>GCTS_68 
          Length = 6534396

 Score =  188 bits (95), Expect = 9e-48
 Identities = 98/99 (98%)
 Strand = Plus / Plus

                                                                          
Query: 61     tatcttcttttcggtggcgttcgactcctgcgtctgcgaagtgttaccggagcaactacg 120
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 782005 tatcttcttttcggtggcgttcgactcctgcgtctgcgaagtgttaccggagcaactacg 782064

                                                     
Query: 121    ccggagcgcaattcgatttcaggttatacccgcgacctc 159
              |||||||||||||||||||||||||||| ||||||||||
Sbjct: 782065 ccggagcgcaattcgatttcaggttatatccgcgacctc 782103

 Score = 46.1 bits (23), Expect = 8e-05
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 184    agtttttttgcgctgttctaata 206
              |||||||||||||||||||||||
Sbjct: 782128 agtttttttgcgctgttctaata 782150

 Score = 32.2 bits (16), Expect = 1.2
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 376     tcttttttcgcttttt 391
               ||||||||||||||||
Sbjct: 3251040 tcttttttcgcttttt 3251025

 Score = 30.2 bits (15), Expect = 4.8
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 576    gctttccggaatgtt 590
              |||||||||||||||
Sbjct: 321188 gctttccggaatgtt 321174

 Score = 30.2 bits (15), Expect = 4.8
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 584     gaatgtttttgtgtc 598
               |||||||||||||||
Sbjct: 4594390 gaatgtttttgtgtc 4594376
  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1814
Number of Sequences: 1
Number of extensions: 1814
Number of successful extensions: 5
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 5
length of query: 933
length of database: 6,534,396
effective HSP length: 16
effective length of query: 917
effective length of database: 6,534,380
effective search space: 5992026460
effective search space used: 5992026460
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)