BLAST Search Results

BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= 
         (1060 letters)

Distribution of 92 Blast Hits on the Query Sequence



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                           577   e-164 

>GCTS_68 
          Length = 6534396

 Score =  577 bits (291), Expect = e-164
 Identities = 339/355 (95%)
 Strand = Plus / Plus

                                                                          
Query: 116    tacatgggcatctggttccccgacgtgccgcgctggatctgggccctggcggccctggcg 175
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 160972 tacatgggcatctggttccccgacgtgccgcgctggatctgggccctggcggccctggcg 161031

                                                                          
Query: 176    agcatgggcacgatcaacctcatcgcggtgcgtgccttcggcgagttcgagttctggttc 235
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 161032 agcatgggcacgatcaacctcatcgcggtgcgtgccttcggcgagttcgagttctggttc 161091

                                                                          
Query: 236    gccctgatcaagatcgtcaccatcctggcgatggcggtggacggcatctgcatgatcgcc 295
              |||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||
Sbjct: 161092 gccctgatcaagatcgtcaccatcctggcgatggtggtggtcggcatcggcatgatcgcc 161151

                                                                          
Query: 296    ttcggcttcggcaactacggcatcgccaccggtatctccaacctctgggtccacggccgc 355
              ||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| ||
Sbjct: 161152 ttcggcttcggcaacgacggcatcgccaccggtatctccaacctctgggcccacggcggc 161211

                                                                          
Query: 356    ttcatgtccaatggtatccagggcgtgctgatgtcactgctgatggtgatgttcgcctac 415
              |||||| ||||||| |||||||||||||||||||| |||| |||||||||||||||||||
Sbjct: 161212 ttcatgcccaatggcatccagggcgtgctgatgtcgctgcagatggtgatgttcgcctac 161271

                                                                     
Query: 416    ctcggggcggaaatgatcggcctctccggcggcgtagcgcgtttcccgaccaaga 470
              ||||||| |||||||||||||||| ||| ||||| |||||||  |||||||||||
Sbjct: 161272 ctcggggtggaaatgatcggcctcaccgccggcgaagcgcgtaacccgaccaaga 161326




 Score = 61.9 bits (31), Expect = 2e-09
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                          
Query: 116     tacatgggcatctggttccccgacgtgccgcgctggatctggg 158
               ||||||||  ||||||| |||||||||||||||||||||||||
Sbjct: 5275442 tacatggggttctggtttcccgacgtgccgcgctggatctggg 5275400




 Score = 54.0 bits (27), Expect = 4e-07
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                          
Query: 205     gcgtgccttcggcgagttcgagttctggttcgccctgatcaag 247
               ||||| ||||||||||  ||| |||||||||||||||||||||
Sbjct: 4731472 gcgtggcttcggcgagagcgaattctggttcgccctgatcaag 4731514




 Score = 44.1 bits (22), Expect = 4e-04
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 214     cggcgagttcgagttctggttcgccctgatcaag 247
               |||||||||||| ||||||||||| ||| |||||
Sbjct: 5946180 cggcgagttcgaattctggttcgcgctgctcaag 5946147




 Score = 42.1 bits (21), Expect = 0.001
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 209     gccttcggcgagttcgagttctggttcgc 237
               ||||||||||||  |||||||||||||||
Sbjct: 2743308 gccttcggcgagaccgagttctggttcgc 2743280




 Score = 38.2 bits (19), Expect = 0.022
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                  
Query: 432     tcggcctctccggcggcgt 450
               |||||||||||||||||||
Sbjct: 3654001 tcggcctctccggcggcgt 3653983




 Score = 38.2 bits (19), Expect = 0.022
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                      
Query: 209     gccttcggcgagttcgagttctggttcgccctgatcaag 247
               ||||||||||||  ||||| ||||||||||  |||||||
Sbjct: 5129734 gccttcggcgaggccgagtactggttcgccgggatcaag 5129696




 Score = 34.2 bits (17), Expect = 0.35
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                           
Query: 209    gccttcggcgagttcgagttctggttcgc 237
              |||||||||||   |||||||||||||||
Sbjct: 249948 gccttcggcgaagccgagttctggttcgc 249976




 Score = 34.2 bits (17), Expect = 0.35
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 160    cctggcggccctggcga 176
              |||||||||||||||||
Sbjct: 504958 cctggcggccctggcga 504942




 Score = 34.2 bits (17), Expect = 0.35
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 291     tcgccttcggcttcggc 307
               |||||||||||||||||
Sbjct: 3960047 tcgccttcggcttcggc 3960031




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                              
Query: 259    cctggcgatggcggtg 274
              ||||||||||||||||
Sbjct: 656432 cctggcgatggcggtg 656417




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                              
Query: 160    cctggcggccctggcg 175
              ||||||||||||||||
Sbjct: 785449 cctggcggccctggcg 785434




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                              
Query: 157    ggccctggcggccctg 172
              ||||||||||||||||
Sbjct: 859923 ggccctggcggccctg 859938




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 22/24 (91%)
 Strand = Plus / Minus

                                       
Query: 295     cttcggcttcggcaactacggcat 318
               |||||||  |||||||||||||||
Sbjct: 1523532 cttcggcgccggcaactacggcat 1523509




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                   
Query: 304     cggcaactacggcatcgcca 323
               |||| |||||||||||||||
Sbjct: 1595080 cggcgactacggcatcgcca 1595099




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 211     cttcggcgagttcgag 226
               ||||||||||||||||
Sbjct: 1706397 cttcggcgagttcgag 1706382




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 145     gcgctggatctgggcc 160
               ||||||||||||||||
Sbjct: 2464461 gcgctggatctgggcc 2464446




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 157     ggccctggcggccctg 172
               ||||||||||||||||
Sbjct: 2493795 ggccctggcggccctg 2493810




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 598     cttcctcgatgacctt 613
               ||||||||||||||||
Sbjct: 2629641 cttcctcgatgacctt 2629626




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 160     cctggcggccctggcg 175
               ||||||||||||||||
Sbjct: 3262971 cctggcggccctggcg 3262986




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 260     ctggcgatggcggtgg 275
               ||||||||||||||||
Sbjct: 3386503 ctggcgatggcggtgg 3386518




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 160     cctggcggccctggcg 175
               ||||||||||||||||
Sbjct: 3418412 cctggcggccctggcg 3418397




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                                   
Query: 259     cctggcgatggcggtggacg 278
               ||||||| ||||||||||||
Sbjct: 3571457 cctggcgctggcggtggacg 3571438




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                   
Query: 435     gcctctccggcggcgtagcg 454
               ||||| ||||||||||||||
Sbjct: 3811264 gcctcgccggcggcgtagcg 3811283




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 160     cctggcggccctggcg 175
               ||||||||||||||||
Sbjct: 4041094 cctggcggccctggcg 4041109




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 169     cctggcgagcatgggc 184
               ||||||||||||||||
Sbjct: 4081800 cctggcgagcatgggc 4081815




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                   
Query: 126     tctggttccccgacgtgccg 145
               ||||||||||||| ||||||
Sbjct: 4731393 tctggttccccgaggtgccg 4731412




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                                   
Query: 297     tcggcttcggcaactacggc 316
               ||||||||||| ||||||||
Sbjct: 4829527 tcggcttcggcgactacggc 4829508




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 161     ctggcggccctggcga 176
               ||||||||||||||||
Sbjct: 4943847 ctggcggccctggcga 4943832




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 208     tgccttcggcgagttc 223
               ||||||||||||||||
Sbjct: 5049543 tgccttcggcgagttc 5049528




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 244     caagatcgtcaccatc 259
               ||||||||||||||||
Sbjct: 5503799 caagatcgtcaccatc 5503814




 Score = 32.2 bits (16), Expect = 1.4
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 286     catgatcgccttcggc 301
               ||||||||||||||||
Sbjct: 5694230 catgatcgccttcggc 5694245




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                            
Query: 295   cttcggcttcggcaa 309
             |||||||||||||||
Sbjct: 39934 cttcggcttcggcaa 39948




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 246    agatcgtcaccatcc 260
              |||||||||||||||
Sbjct: 215706 agatcgtcaccatcc 215720




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 160    cctggcggccctggc 174
              |||||||||||||||
Sbjct: 312871 cctggcggccctggc 312857




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                 
Query: 214    cggcgagttcgagttctgg 232
              |||||||||||| ||||||
Sbjct: 383289 cggcgagttcgaattctgg 383307




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 257    atcctggcgatggcg 271
              |||||||||||||||
Sbjct: 451944 atcctggcgatggcg 451958




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 277    cggcatctgcatgat 291
              |||||||||||||||
Sbjct: 496353 cggcatctgcatgat 496339




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 413    tacctcggggcggaa 427
              |||||||||||||||
Sbjct: 572663 tacctcggggcggaa 572677




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 157     ggccctggcggccctggcg 175
               ||||||||||||| |||||
Sbjct: 1003599 ggccctggcggccatggcg 1003617




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 149     tggatctgggccctg 163
               |||||||||||||||
Sbjct: 1109417 tggatctgggccctg 1109403




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 247     gatcgtcaccatcctggcg 265
               ||||||||||| |||||||
Sbjct: 1141853 gatcgtcaccagcctggcg 1141871




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 309     actacggcatcgcca 323
               |||||||||||||||
Sbjct: 1215421 actacggcatcgcca 1215407




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 160     cctggcggccctggc 174
               |||||||||||||||
Sbjct: 1221479 cctggcggccctggc 1221493




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 435     gcctctccggcggcg 449
               |||||||||||||||
Sbjct: 1342053 gcctctccggcggcg 1342039




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 214     cggcgagttcgagtt 228
               |||||||||||||||
Sbjct: 1596280 cggcgagttcgagtt 1596294




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 237     ccctgatcaagatcg 251
               |||||||||||||||
Sbjct: 1877369 ccctgatcaagatcg 1877383




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 21/23 (91%)
 Strand = Plus / Minus

                                      
Query: 253     caccatcctggcgatggcggtgg 275
               ||||| ||||||||||| |||||
Sbjct: 1942093 caccagcctggcgatggtggtgg 1942071




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 267     tggcggtggacggca 281
               |||||||||||||||
Sbjct: 1986908 tggcggtggacggca 1986894




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 267     tggcggtggacggca 281
               |||||||||||||||
Sbjct: 1994489 tggcggtggacggca 1994475




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 161     ctggcggccctggcg 175
               |||||||||||||||
Sbjct: 2052465 ctggcggccctggcg 2052451




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 267     tggcggtggacggca 281
               |||||||||||||||
Sbjct: 2072516 tggcggtggacggca 2072502




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 476     ccctggctgatcaac 490
               |||||||||||||||
Sbjct: 2096682 ccctggctgatcaac 2096696




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 405     tgttcgcctacctcggggc 423
               ||||| |||||||||||||
Sbjct: 2260206 tgttcacctacctcggggc 2260224




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 253     caccatcctggcgat 267
               |||||||||||||||
Sbjct: 2371828 caccatcctggcgat 2371814




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 250     cgtcaccatcctggc 264
               |||||||||||||||
Sbjct: 2434976 cgtcaccatcctggc 2434990




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 120     tgggcatctggttcc 134
               |||||||||||||||
Sbjct: 2453099 tgggcatctggttcc 2453113




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 140     gtgccgcgctggatc 154
               |||||||||||||||
Sbjct: 2679433 gtgccgcgctggatc 2679419




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 545     gatcctctacgccct 559
               |||||||||||||||
Sbjct: 2695653 gatcctctacgccct 2695639




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 263     gcgatggcggtggac 277
               |||||||||||||||
Sbjct: 2966867 gcgatggcggtggac 2966881




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 373     ccagggcgtgctgat 387
               |||||||||||||||
Sbjct: 3068208 ccagggcgtgctgat 3068222




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 373     ccagggcgtgctgat 387
               |||||||||||||||
Sbjct: 3110419 ccagggcgtgctgat 3110405




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 158     gccctggcggccctggcga 176
               ||||||||||| |||||||
Sbjct: 3113371 gccctggcggcgctggcga 3113389




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 903     ctgacccgcgcgttc 917
               |||||||||||||||
Sbjct: 3299079 ctgacccgcgcgttc 3299065




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 664     tccttggtcgccttc 678
               |||||||||||||||
Sbjct: 3346380 tccttggtcgccttc 3346366




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 261     tggcgatggcggtgg 275
               |||||||||||||||
Sbjct: 3682642 tggcgatggcggtgg 3682628




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 149     tggatctgggccctg 163
               |||||||||||||||
Sbjct: 3731418 tggatctgggccctg 3731404




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 313     cggcatcgccaccgg 327
               |||||||||||||||
Sbjct: 3736647 cggcatcgccaccgg 3736661




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 442     cggcggcgtagcgcg 456
               |||||||||||||||
Sbjct: 3849769 cggcggcgtagcgcg 3849755




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 269     gcggtggacggcatc 283
               |||||||||||||||
Sbjct: 3902324 gcggtggacggcatc 3902338




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 241     gatcaagatcgtcaccatc 259
               ||||||||||| |||||||
Sbjct: 3962710 gatcaagatcggcaccatc 3962692




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 203     gtgcgtgccttcggc 217
               |||||||||||||||
Sbjct: 4088105 gtgcgtgccttcggc 4088119




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 282     tctgcatgatcgcct 296
               |||||||||||||||
Sbjct: 4133423 tctgcatgatcgcct 4133409




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 224     gagttctggttcgcc 238
               |||||||||||||||
Sbjct: 4229053 gagttctggttcgcc 4229039




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 21/23 (91%)
 Strand = Plus / Minus

                                      
Query: 277     cggcatctgcatgatcgccttcg 299
               ||||||| ||| |||||||||||
Sbjct: 4380524 cggcatcagcaagatcgccttcg 4380502




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 436     cctctccggcggcgt 450
               |||||||||||||||
Sbjct: 4600117 cctctccggcggcgt 4600131




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 226     gttctggttcgccctgatc 244
               ||||||| |||||||||||
Sbjct: 4629309 gttctggatcgccctgatc 4629327




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 1035    ctctcccgtcgccgc 1049
               |||||||||||||||
Sbjct: 4630628 ctctcccgtcgccgc 4630642




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 213     tcggcgagttcgagt 227
               |||||||||||||||
Sbjct: 4719787 tcggcgagttcgagt 4719801




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 290     atcgccttcggcttc 304
               |||||||||||||||
Sbjct: 4834678 atcgccttcggcttc 4834692




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 286     catgatcgccttcgg 300
               |||||||||||||||
Sbjct: 4842375 catgatcgccttcgg 4842361




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 161     ctggcggccctggcg 175
               |||||||||||||||
Sbjct: 4870637 ctggcggccctggcg 4870623




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 142     gccgcgctggatctg 156
               |||||||||||||||
Sbjct: 4928001 gccgcgctggatctg 4928015




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 1039    cccgtcgccgctccgcgtg 1057
               ||||||||||| |||||||
Sbjct: 5212790 cccgtcgccgcgccgcgtg 5212772




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 252     tcaccatcctggcga 266
               |||||||||||||||
Sbjct: 5300254 tcaccatcctggcga 5300240




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 303     tcggcaactacggca 317
               |||||||||||||||
Sbjct: 5427295 tcggcaactacggca 5427281




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 261     tggcgatggcggtgg 275
               |||||||||||||||
Sbjct: 5703907 tggcgatggcggtgg 5703921




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 291     tcgccttcggcttcg 305
               |||||||||||||||
Sbjct: 5801926 tcgccttcggcttcg 5801912




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 476     ccctggctgatcaac 490
               |||||||||||||||
Sbjct: 5848556 ccctggctgatcaac 5848542




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 158     gccctggcggccctggcga 176
               |||||||||||||| ||||
Sbjct: 5856273 gccctggcggcccttgcga 5856291




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 291     tcgccttcggcttcg 305
               |||||||||||||||
Sbjct: 5929436 tcgccttcggcttcg 5929450




 Score = 30.2 bits (15), Expect = 5.4
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 291     tcgccttcggcttcggcaa 309
               ||||||||||| |||||||
Sbjct: 6363551 tcgccttcggcgtcggcaa 6363533




  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6923
Number of Sequences: 1
Number of extensions: 6923
Number of successful extensions: 92
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 92
length of query: 1060
length of database: 6,534,396
effective HSP length: 17
effective length of query: 1043
effective length of database: 6,534,379
effective search space: 6815357297
effective search space used: 6815357297
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)