BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= (1172 letters)

Distribution of 20 Blast Hits on the Query Sequence




                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                           174   2e-43 
>GCTS_68 
          Length = 6534396

 Score =  174 bits (88), Expect = 2e-43
 Identities = 155/176 (88%), Gaps = 1/176 (0%)
 Strand = Plus / Minus

                                                                           
Query: 117     tagatggatctcgacactcatgcgctgactccccgtctctgcgg-gcctggccactggag 175
               ||||||||||||||||||||||||||||||||| | |||||||  || |     ||||||
Sbjct: 5916893 tagatggatctcgacactcatgcgctgactccctggctctgcgccgcttcagttctggag 5916834

                                                                           
Query: 176     gatcttgcgtcccttcaccaccacgttcttgtcggccttgatgttgatcgccccggatcc 235
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5916833 gatcttgcgtcccttcaccaccacgttcttgtcggccttgatgttgatcgccccggatcc 5916774

                                                                       
Query: 236     gtcgacggtggggctgttgaggctgaagacggtgctgccgaccttcttgatgcgga 291
               ||||| ||||  | | |||  ||||| |||| |||||||| ||||||| |||||||
Sbjct: 5916773 gtcgatggtgatgttcttgccgctgatgacgatgctgccgtccttcttcatgcgga 5916718

 Score = 36.2 bits (18), Expect = 0.097
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 161     gcctggccactggaggat 178
               ||||||||||||||||||
Sbjct: 3902237 gcctggccactggaggat 3902254

 Score = 34.2 bits (17), Expect = 0.38
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 205     tgtcggccttgatgttg 221
               |||||||||||||||||
Sbjct: 1011323 tgtcggccttgatgttg 1011339

 Score = 32.2 bits (16), Expect = 1.5
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 297     cggaacggggtgacga 312
               ||||||||||||||||
Sbjct: 3786116 cggaacggggtgacga 3786101

 Score = 32.2 bits (16), Expect = 1.5
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 265     cggtgctgccgacctt 280
               ||||||||||||||||
Sbjct: 4364082 cggtgctgccgacctt 4364097

 Score = 32.2 bits (16), Expect = 1.5
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 1054    ggcccagcgcaacaag 1069
               ||||||||||||||||
Sbjct: 4498050 ggcccagcgcaacaag 4498065

 Score = 32.2 bits (16), Expect = 1.5
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 258     ctgaagacggtgctgc 273
               ||||||||||||||||
Sbjct: 5322854 ctgaagacggtgctgc 5322839

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 265    cggtgctgccgacct 279
              |||||||||||||||
Sbjct: 118214 cggtgctgccgacct 118228

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                 
Query: 206    gtcggccttgatgttgatc 224
              |||| ||||||||||||||
Sbjct: 719211 gtcgcccttgatgttgatc 719229

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 170     ctggaggatcttgcg 184
               |||||||||||||||
Sbjct: 1014712 ctggaggatcttgcg 1014698

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 265     cggtgctgccgacct 279
               |||||||||||||||
Sbjct: 1019369 cggtgctgccgacct 1019383

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 205     tgtcggccttgatgt 219
               |||||||||||||||
Sbjct: 1294110 tgtcggccttgatgt 1294096

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 222     atcgccccggatccg 236
               |||||||||||||||
Sbjct: 2166484 atcgccccggatccg 2166470

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 157     gcgggcctggccactggag 175
               ||||||||||||| |||||
Sbjct: 4578645 gcgggcctggccaatggag 4578663

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 1060    gcgcaacaaggtgagcgac 1078
               |||||||||||||| ||||
Sbjct: 4624538 gcgcaacaaggtgaccgac 4624520

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 969     ttgatcagtacggtt 983
               |||||||||||||||
Sbjct: 4775321 ttgatcagtacggtt 4775307

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 1053    tggcccagcgcaaca 1067
               |||||||||||||||
Sbjct: 5614485 tggcccagcgcaaca 5614499

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 572     acctgcagggccgtt 586
               |||||||||||||||
Sbjct: 5653808 acctgcagggccgtt 5653794

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 268     tgctgccgaccttct 282
               |||||||||||||||
Sbjct: 5916399 tgctgccgaccttct 5916385

 Score = 30.2 bits (15), Expect = 6.0
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 191     caccaccacgttctt 205
               |||||||||||||||
Sbjct: 6488924 caccaccacgttctt 6488910
  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2704
Number of Sequences: 1
Number of extensions: 2704
Number of successful extensions: 21
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 21
length of query: 1172
length of database: 6,534,396
effective HSP length: 17
effective length of query: 1155
effective length of database: 6,534,379
effective search space: 7547207745
effective search space used: 7547207745
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)