BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= (142 letters)

Distribution of 20 Blast Hits on the Query Sequence




                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                           155   2e-38 
>GCTS_68 
          Length = 6534396

 Score =  155 bits (78), Expect = 2e-38
 Identities = 112/122 (91%), Gaps = 1/122 (0%)
 Strand = Plus / Minus

                                                                           
Query: 22      tagatggatctcgacactcatgcgctgactccccgtctctgcgg-gcctggccactggag 80
               ||||||||||||||||||||||||||||||||| | |||||||  || |     ||||||
Sbjct: 5916893 tagatggatctcgacactcatgcgctgactccctggctctgcgccgcttcagttctggag 5916834

                                                                           
Query: 81      gatcttgcgtcccttcaccaccacgttcttgtcggccttgatgttgatcgccccggatcc 140
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5916833 gatcttgcgtcccttcaccaccacgttcttgtcggccttgatgttgatcgccccggatcc 5916774

                 
Query: 141     gt 142
               ||
Sbjct: 5916773 gt 5916772

 Score = 36.2 bits (18), Expect = 0.011
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 66      gcctggccactggaggat 83
               ||||||||||||||||||
Sbjct: 3902237 gcctggccactggaggat 3902254

 Score = 34.2 bits (17), Expect = 0.042
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 110     tgtcggccttgatgttg 126
               |||||||||||||||||
Sbjct: 1011323 tgtcggccttgatgttg 1011339

 Score = 30.2 bits (15), Expect = 0.66
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                 
Query: 111    gtcggccttgatgttgatc 129
              |||| ||||||||||||||
Sbjct: 719211 gtcgcccttgatgttgatc 719229

 Score = 30.2 bits (15), Expect = 0.66
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 75      ctggaggatcttgcg 89
               |||||||||||||||
Sbjct: 1014712 ctggaggatcttgcg 1014698

 Score = 30.2 bits (15), Expect = 0.66
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 110     tgtcggccttgatgt 124
               |||||||||||||||
Sbjct: 1294110 tgtcggccttgatgt 1294096

 Score = 30.2 bits (15), Expect = 0.66
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 127     atcgccccggatccg 141
               |||||||||||||||
Sbjct: 2166484 atcgccccggatccg 2166470

 Score = 30.2 bits (15), Expect = 0.66
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 62      gcgggcctggccactggag 80
               ||||||||||||| |||||
Sbjct: 4578645 gcgggcctggccaatggag 4578663

 Score = 30.2 bits (15), Expect = 0.66
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 96      caccaccacgttctt 110
               |||||||||||||||
Sbjct: 6488924 caccaccacgttctt 6488910

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 17/18 (94%)
 Strand = Plus / Minus

                                
Query: 100    accacgttcttgtcggcc 117
              |||||||||||| |||||
Sbjct: 488053 accacgttcttggcggcc 488036

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                            
Query: 26     tggatctcgacact 39
              ||||||||||||||
Sbjct: 795579 tggatctcgacact 795566

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 111     gtcggccttgatgt 124
               ||||||||||||||
Sbjct: 1028962 gtcggccttgatgt 1028949

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 116     ccttgatgttgatc 129
               ||||||||||||||
Sbjct: 2717745 ccttgatgttgatc 2717732

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 106     ttcttgtcggcctt 119
               ||||||||||||||
Sbjct: 2975801 ttcttgtcggcctt 2975788

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 62      gcgggcctggccac 75
               ||||||||||||||
Sbjct: 3551646 gcgggcctggccac 3551659

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 96      caccaccacgttct 109
               ||||||||||||||
Sbjct: 4073364 caccaccacgttct 4073351

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 17/18 (94%)
 Strand = Plus / Plus

                                 
Query: 106     ttcttgtcggccttgatg 123
               |||||| |||||||||||
Sbjct: 4202402 ttcttggcggccttgatg 4202419

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 110     tgtcggccttgatg 123
               ||||||||||||||
Sbjct: 4810393 tgtcggccttgatg 4810406

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 126     gatcgccccggatc 139
               ||||||||||||||
Sbjct: 5474642 gatcgccccggatc 5474655

 Score = 28.2 bits (14), Expect = 2.6
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 120     gatgttgatcgccc 133
               ||||||||||||||
Sbjct: 5638011 gatgttgatcgccc 5637998
  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 859
Number of Sequences: 1
Number of extensions: 859
Number of successful extensions: 21
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 21
length of query: 142
length of database: 6,534,396
effective HSP length: 15
effective length of query: 127
effective length of database: 6,534,381
effective search space: 829866387
effective search space used: 829866387
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 14 (28.2 bits)