BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= 
         (233 letters)

Distribution of 146 Blast Hits on the Query Sequence 



                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                           355   2e-98 



>GCTS_68 
          Length = 6534396

 Score =  355 bits (179), Expect = 2e-98
 Identities = 188/191 (98%)
 Strand = Plus / Plus

                                                                          
Query: 43     tacatgggcatctggttccccgacgtgccgcgctggatctgggccctggcggccctggcg 102
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 160972 tacatgggcatctggttccccgacgtgccgcgctggatctgggccctggcggccctggcg 161031

                                                                          
Query: 103    agcatgggcacgatcaacctcatcgcggtgcgtgccttcggcgagttcgagttctggttc 162
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 161032 agcatgggcacgatcaacctcatcgcggtgcgtgccttcggcgagttcgagttctggttc 161091

                                                                          
Query: 163    gccctgatcaagatcgtcaccatcctggcgatggcggtggacggcatctgcatgatcgcc 222
              |||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||
Sbjct: 161092 gccctgatcaagatcgtcaccatcctggcgatggtggtggtcggcatcggcatgatcgcc 161151

                         
Query: 223    ttcggcttcgg 233
              |||||||||||
Sbjct: 161152 ttcggcttcgg 161162






 Score = 61.9 bits (31), Expect = 3e-10
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                          
Query: 43      tacatgggcatctggttccccgacgtgccgcgctggatctggg 85
               ||||||||  ||||||| |||||||||||||||||||||||||
Sbjct: 5275442 tacatggggttctggtttcccgacgtgccgcgctggatctggg 5275400






 Score = 54.0 bits (27), Expect = 8e-08
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                          
Query: 132     gcgtgccttcggcgagttcgagttctggttcgccctgatcaag 174
               ||||| ||||||||||  ||| |||||||||||||||||||||
Sbjct: 4731472 gcgtggcttcggcgagagcgaattctggttcgccctgatcaag 4731514






 Score = 44.1 bits (22), Expect = 8e-05
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 141     cggcgagttcgagttctggttcgccctgatcaag 174
               |||||||||||| ||||||||||| ||| |||||
Sbjct: 5946180 cggcgagttcgaattctggttcgcgctgctcaag 5946147






 Score = 42.1 bits (21), Expect = 3e-04
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 136     gccttcggcgagttcgagttctggttcgc 164
               ||||||||||||  |||||||||||||||
Sbjct: 2743308 gccttcggcgagaccgagttctggttcgc 2743280






 Score = 38.2 bits (19), Expect = 0.005
 Identities = 34/39 (87%)
 Strand = Plus / Minus

                                                      
Query: 136     gccttcggcgagttcgagttctggttcgccctgatcaag 174
               ||||||||||||  ||||| ||||||||||  |||||||
Sbjct: 5129734 gccttcggcgaggccgagtactggttcgccgggatcaag 5129696






 Score = 34.2 bits (17), Expect = 0.073
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                           
Query: 136    gccttcggcgagttcgagttctggttcgc 164
              |||||||||||   |||||||||||||||
Sbjct: 249948 gccttcggcgaagccgagttctggttcgc 249976






 Score = 34.2 bits (17), Expect = 0.073
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 87     cctggcggccctggcga 103
              |||||||||||||||||
Sbjct: 504958 cctggcggccctggcga 504942






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                              
Query: 186    cctggcgatggcggtg 201
              ||||||||||||||||
Sbjct: 656432 cctggcgatggcggtg 656417






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                              
Query: 87     cctggcggccctggcg 102
              ||||||||||||||||
Sbjct: 785449 cctggcggccctggcg 785434






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                              
Query: 84     ggccctggcggccctg 99
              ||||||||||||||||
Sbjct: 859923 ggccctggcggccctg 859938






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 138     cttcggcgagttcgag 153
               ||||||||||||||||
Sbjct: 1706397 cttcggcgagttcgag 1706382






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 72      gcgctggatctgggcc 87
               ||||||||||||||||
Sbjct: 2464461 gcgctggatctgggcc 2464446






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 84      ggccctggcggccctg 99
               ||||||||||||||||
Sbjct: 2493795 ggccctggcggccctg 2493810






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 87      cctggcggccctggcg 102
               ||||||||||||||||
Sbjct: 3262971 cctggcggccctggcg 3262986






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 187     ctggcgatggcggtgg 202
               ||||||||||||||||
Sbjct: 3386503 ctggcgatggcggtgg 3386518






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 87      cctggcggccctggcg 102
               ||||||||||||||||
Sbjct: 3418412 cctggcggccctggcg 3418397






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                                   
Query: 186     cctggcgatggcggtggacg 205
               ||||||| ||||||||||||
Sbjct: 3571457 cctggcgctggcggtggacg 3571438






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 218     tcgccttcggcttcgg 233
               ||||||||||||||||
Sbjct: 3960047 tcgccttcggcttcgg 3960032






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 87      cctggcggccctggcg 102
               ||||||||||||||||
Sbjct: 4041094 cctggcggccctggcg 4041109






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 96      cctggcgagcatgggc 111
               ||||||||||||||||
Sbjct: 4081800 cctggcgagcatgggc 4081815






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                   
Query: 53      tctggttccccgacgtgccg 72
               ||||||||||||| ||||||
Sbjct: 4731393 tctggttccccgaggtgccg 4731412






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 88      ctggcggccctggcga 103
               ||||||||||||||||
Sbjct: 4943847 ctggcggccctggcga 4943832






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 135     tgccttcggcgagttc 150
               ||||||||||||||||
Sbjct: 5049543 tgccttcggcgagttc 5049528






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 171     caagatcgtcaccatc 186
               ||||||||||||||||
Sbjct: 5503799 caagatcgtcaccatc 5503814






 Score = 32.2 bits (16), Expect = 0.29
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 213     catgatcgccttcggc 228
               ||||||||||||||||
Sbjct: 5694230 catgatcgccttcggc 5694245






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 173    agatcgtcaccatcc 187
              |||||||||||||||
Sbjct: 215706 agatcgtcaccatcc 215720






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 87     cctggcggccctggc 101
              |||||||||||||||
Sbjct: 312871 cctggcggccctggc 312857






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                 
Query: 141    cggcgagttcgagttctgg 159
              |||||||||||| ||||||
Sbjct: 383289 cggcgagttcgaattctgg 383307






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 184    atcctggcgatggcg 198
              |||||||||||||||
Sbjct: 451944 atcctggcgatggcg 451958






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 204    cggcatctgcatgat 218
              |||||||||||||||
Sbjct: 496353 cggcatctgcatgat 496339






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 84      ggccctggcggccctggcg 102
               ||||||||||||| |||||
Sbjct: 1003599 ggccctggcggccatggcg 1003617






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 76      tggatctgggccctg 90
               |||||||||||||||
Sbjct: 1109417 tggatctgggccctg 1109403






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 174     gatcgtcaccatcctggcg 192
               ||||||||||| |||||||
Sbjct: 1141853 gatcgtcaccagcctggcg 1141871






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 87      cctggcggccctggc 101
               |||||||||||||||
Sbjct: 1221479 cctggcggccctggc 1221493






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 141     cggcgagttcgagtt 155
               |||||||||||||||
Sbjct: 1596280 cggcgagttcgagtt 1596294






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 164     ccctgatcaagatcg 178
               |||||||||||||||
Sbjct: 1877369 ccctgatcaagatcg 1877383






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 21/23 (91%)
 Strand = Plus / Minus

                                      
Query: 180     caccatcctggcgatggcggtgg 202
               ||||| ||||||||||| |||||
Sbjct: 1942093 caccagcctggcgatggtggtgg 1942071






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 194     tggcggtggacggca 208
               |||||||||||||||
Sbjct: 1986908 tggcggtggacggca 1986894






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 194     tggcggtggacggca 208
               |||||||||||||||
Sbjct: 1994489 tggcggtggacggca 1994475






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 88      ctggcggccctggcg 102
               |||||||||||||||
Sbjct: 2052465 ctggcggccctggcg 2052451






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 194     tggcggtggacggca 208
               |||||||||||||||
Sbjct: 2072516 tggcggtggacggca 2072502






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 180     caccatcctggcgat 194
               |||||||||||||||
Sbjct: 2371828 caccatcctggcgat 2371814






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 177     cgtcaccatcctggc 191
               |||||||||||||||
Sbjct: 2434976 cgtcaccatcctggc 2434990






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 47      tgggcatctggttcc 61
               |||||||||||||||
Sbjct: 2453099 tgggcatctggttcc 2453113






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 67      gtgccgcgctggatc 81
               |||||||||||||||
Sbjct: 2679433 gtgccgcgctggatc 2679419






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 190     gcgatggcggtggac 204
               |||||||||||||||
Sbjct: 2966867 gcgatggcggtggac 2966881






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 85      gccctggcggccctggcga 103
               ||||||||||| |||||||
Sbjct: 3113371 gccctggcggcgctggcga 3113389






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 188     tggcgatggcggtgg 202
               |||||||||||||||
Sbjct: 3682642 tggcgatggcggtgg 3682628






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 76      tggatctgggccctg 90
               |||||||||||||||
Sbjct: 3731418 tggatctgggccctg 3731404






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 196     gcggtggacggcatc 210
               |||||||||||||||
Sbjct: 3902324 gcggtggacggcatc 3902338






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 168     gatcaagatcgtcaccatc 186
               ||||||||||| |||||||
Sbjct: 3962710 gatcaagatcggcaccatc 3962692






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 130     gtgcgtgccttcggc 144
               |||||||||||||||
Sbjct: 4088105 gtgcgtgccttcggc 4088119






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 209     tctgcatgatcgcct 223
               |||||||||||||||
Sbjct: 4133423 tctgcatgatcgcct 4133409






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 151     gagttctggttcgcc 165
               |||||||||||||||
Sbjct: 4229053 gagttctggttcgcc 4229039






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 21/23 (91%)
 Strand = Plus / Minus

                                      
Query: 204     cggcatctgcatgatcgccttcg 226
               ||||||| ||| |||||||||||
Sbjct: 4380524 cggcatcagcaagatcgccttcg 4380502






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 153     gttctggttcgccctgatc 171
               ||||||| |||||||||||
Sbjct: 4629309 gttctggatcgccctgatc 4629327






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 140     tcggcgagttcgagt 154
               |||||||||||||||
Sbjct: 4719787 tcggcgagttcgagt 4719801






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 217     atcgccttcggcttc 231
               |||||||||||||||
Sbjct: 4834678 atcgccttcggcttc 4834692






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 213     catgatcgccttcgg 227
               |||||||||||||||
Sbjct: 4842375 catgatcgccttcgg 4842361






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 88      ctggcggccctggcg 102
               |||||||||||||||
Sbjct: 4870637 ctggcggccctggcg 4870623






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 69      gccgcgctggatctg 83
               |||||||||||||||
Sbjct: 4928001 gccgcgctggatctg 4928015






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 179     tcaccatcctggcga 193
               |||||||||||||||
Sbjct: 5300254 tcaccatcctggcga 5300240






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 188     tggcgatggcggtgg 202
               |||||||||||||||
Sbjct: 5703907 tggcgatggcggtgg 5703921






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 218     tcgccttcggcttcg 232
               |||||||||||||||
Sbjct: 5801926 tcgccttcggcttcg 5801912






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 85      gccctggcggccctggcga 103
               |||||||||||||| ||||
Sbjct: 5856273 gccctggcggcccttgcga 5856291






 Score = 30.2 bits (15), Expect = 1.1
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 218     tcgccttcggcttcg 232
               |||||||||||||||
Sbjct: 5929436 tcgccttcggcttcg 5929450






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                           
Query: 204   cggcatctgcatga 217
             ||||||||||||||
Sbjct: 36927 cggcatctgcatga 36914






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                            
Query: 98     tggcgagcatgggc 111
              ||||||||||||||
Sbjct: 305548 tggcgagcatgggc 305535






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                            
Query: 89     tggcggccctggcg 102
              ||||||||||||||
Sbjct: 428112 tggcggccctggcg 428099






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 17/18 (94%)
 Strand = Plus / Plus

                                
Query: 61     cccgacgtgccgcgctgg 78
              |||||| |||||||||||
Sbjct: 620501 cccgacctgccgcgctgg 620518






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                            
Query: 68     tgccgcgctggatc 81
              ||||||||||||||
Sbjct: 684367 tgccgcgctggatc 684380






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                            
Query: 138    cttcggcgagttcg 151
              ||||||||||||||
Sbjct: 696467 cttcggcgagttcg 696480






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                            
Query: 138    cttcggcgagttcg 151
              ||||||||||||||
Sbjct: 716244 cttcggcgagttcg 716231






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                            
Query: 89     tggcggccctggcg 102
              ||||||||||||||
Sbjct: 915389 tggcggccctggcg 915402






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                            
Query: 88     ctggcggccctggc 101
              ||||||||||||||
Sbjct: 917198 ctggcggccctggc 917211






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                            
Query: 79     atctgggccctggc 92
              ||||||||||||||
Sbjct: 936824 atctgggccctggc 936811






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 188     tggcgatggcggtg 201
               ||||||||||||||
Sbjct: 1069218 tggcgatggcggtg 1069205






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 189     ggcgatggcggtgg 202
               ||||||||||||||
Sbjct: 1105028 ggcgatggcggtgg 1105041






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 173     agatcgtcaccatc 186
               ||||||||||||||
Sbjct: 1236938 agatcgtcaccatc 1236951






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 167     tgatcaagatcgtc 180
               ||||||||||||||
Sbjct: 1271391 tgatcaagatcgtc 1271404






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 84      ggccctggcggccc 97
               ||||||||||||||
Sbjct: 1289070 ggccctggcggccc 1289057






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 127     gcggtgcgtgcctt 140
               ||||||||||||||
Sbjct: 1463570 gcggtgcgtgcctt 1463583






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 134     gtgccttcggcgag 147
               ||||||||||||||
Sbjct: 1511062 gtgccttcggcgag 1511075






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 95      ccctggcgagcatg 108
               ||||||||||||||
Sbjct: 1548897 ccctggcgagcatg 1548884






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 88      ctggcggccctggc 101
               ||||||||||||||
Sbjct: 1587106 ctggcggccctggc 1587093






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 83      gggccctggcggcc 96
               ||||||||||||||
Sbjct: 1657996 gggccctggcggcc 1658009






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 17/18 (94%)
 Strand = Plus / Plus

                                 
Query: 215     tgatcgccttcggcttcg 232
               ||||||||||| ||||||
Sbjct: 1739760 tgatcgccttctgcttcg 1739777






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 88      ctggcggccctggc 101
               ||||||||||||||
Sbjct: 1788219 ctggcggccctggc 1788232






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 219     cgccttcggcttcg 232
               ||||||||||||||
Sbjct: 1800880 cgccttcggcttcg 1800893






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 184     atcctggcgatggc 197
               ||||||||||||||
Sbjct: 1823447 atcctggcgatggc 1823460






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 160     ttcgccctgatcaa 173
               ||||||||||||||
Sbjct: 1863291 ttcgccctgatcaa 1863278






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 17/18 (94%)
 Strand = Plus / Plus

                                 
Query: 88      ctggcggccctggcgagc 105
               |||||||||||| |||||
Sbjct: 2125561 ctggcggccctgccgagc 2125578






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 134     gtgccttcggcgag 147
               ||||||||||||||
Sbjct: 2181042 gtgccttcggcgag 2181055






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 196     gcggtggacggcat 209
               ||||||||||||||
Sbjct: 2196352 gcggtggacggcat 2196339






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 71      cgcgctggatctgg 84
               ||||||||||||||
Sbjct: 2346911 cgcgctggatctgg 2346898






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 189     ggcgatggcggtgg 202
               ||||||||||||||
Sbjct: 2380612 ggcgatggcggtgg 2380625






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 194     tggcggtggacggc 207
               ||||||||||||||
Sbjct: 2386114 tggcggtggacggc 2386127






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 95      ccctggcgagcatg 108
               ||||||||||||||
Sbjct: 2488076 ccctggcgagcatg 2488089






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 91      gcggccctggcgag 104
               ||||||||||||||
Sbjct: 2809184 gcggccctggcgag 2809171






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 219     cgccttcggcttcg 232
               ||||||||||||||
Sbjct: 2937203 cgccttcggcttcg 2937216






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 90      ggcggccctggcga 103
               ||||||||||||||
Sbjct: 3098631 ggcggccctggcga 3098618






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 96      cctggcgagcatgg 109
               ||||||||||||||
Sbjct: 3108319 cctggcgagcatgg 3108332






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 90      ggcggccctggcga 103
               ||||||||||||||
Sbjct: 3129364 ggcggccctggcga 3129351






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 17/18 (94%)
 Strand = Plus / Plus

                                 
Query: 187     ctggcgatggcggtggac 204
               ||||| ||||||||||||
Sbjct: 3325828 ctggccatggcggtggac 3325845






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 215     tgatcgccttcggc 228
               ||||||||||||||
Sbjct: 3380727 tgatcgccttcggc 3380740






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 88      ctggcggccctggc 101
               ||||||||||||||
Sbjct: 3381767 ctggcggccctggc 3381780






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 90      ggcggccctggcga 103
               ||||||||||||||
Sbjct: 3402436 ggcggccctggcga 3402423






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 17/18 (94%)
 Strand = Plus / Plus

                                 
Query: 84      ggccctggcggccctggc 101
               |||||||||||| |||||
Sbjct: 3414296 ggccctggcggcgctggc 3414313






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 194     tggcggtggacggc 207
               ||||||||||||||
Sbjct: 3484345 tggcggtggacggc 3484332






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 161     tcgccctgatcaag 174
               ||||||||||||||
Sbjct: 3523321 tcgccctgatcaag 3523308






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 183     catcctggcgatgg 196
               ||||||||||||||
Sbjct: 3585581 catcctggcgatgg 3585594






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 20/22 (90%)
 Strand = Plus / Minus

                                     
Query: 138     cttcggcgagttcgagttctgg 159
               ||||||||||||| || |||||
Sbjct: 3601349 cttcggcgagttcaagatctgg 3601328






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 215     tgatcgccttcggc 228
               ||||||||||||||
Sbjct: 3871561 tgatcgccttcggc 3871574






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 200     tggacggcatctgc 213
               ||||||||||||||
Sbjct: 3915118 tggacggcatctgc 3915105






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 186     cctggcgatggcgg 199
               ||||||||||||||
Sbjct: 3918376 cctggcgatggcgg 3918363






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 194     tggcggtggacggc 207
               ||||||||||||||
Sbjct: 4011931 tggcggtggacggc 4011944






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 88      ctggcggccctggc 101
               ||||||||||||||
Sbjct: 4081522 ctggcggccctggc 4081535






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 215     tgatcgccttcggc 228
               ||||||||||||||
Sbjct: 4373830 tgatcgccttcggc 4373817






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 87      cctggcggccctgg 100
               ||||||||||||||
Sbjct: 4645254 cctggcggccctgg 4645241






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 17/18 (94%)
 Strand = Plus / Plus

                                 
Query: 83      gggccctggcggccctgg 100
               |||||||||||| |||||
Sbjct: 4667993 gggccctggcgggcctgg 4668010






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 93      ggccctggcgagca 106
               ||||||||||||||
Sbjct: 4727575 ggccctggcgagca 4727562






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 71      cgcgctggatctgg 84
               ||||||||||||||
Sbjct: 4736353 cgcgctggatctgg 4736340






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 188     tggcgatggcggtg 201
               ||||||||||||||
Sbjct: 4834123 tggcgatggcggtg 4834110






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 87      cctggcggccctgg 100
               ||||||||||||||
Sbjct: 4847542 cctggcggccctgg 4847529






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 204     cggcatctgcatga 217
               ||||||||||||||
Sbjct: 5198634 cggcatctgcatga 5198647






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 116     tcaacctcatcgcg 129
               ||||||||||||||
Sbjct: 5264957 tcaacctcatcgcg 5264944






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 17/18 (94%)
 Strand = Plus / Minus

                                 
Query: 88      ctggcggccctggcgagc 105
               |||||||||||| |||||
Sbjct: 5456669 ctggcggccctgacgagc 5456652






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 187     ctggcgatggcggt 200
               ||||||||||||||
Sbjct: 5588713 ctggcgatggcggt 5588700






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 84      ggccctggcggccc 97
               ||||||||||||||
Sbjct: 5609683 ggccctggcggccc 5609670






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 204     cggcatctgcatga 217
               ||||||||||||||
Sbjct: 5614785 cggcatctgcatga 5614772






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 215     tgatcgccttcggc 228
               ||||||||||||||
Sbjct: 5707220 tgatcgccttcggc 5707233






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 215     tgatcgccttcggc 228
               ||||||||||||||
Sbjct: 5761035 tgatcgccttcggc 5761048






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 138     cttcggcgagttcg 151
               ||||||||||||||
Sbjct: 5820857 cttcggcgagttcg 5820870






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 173     agatcgtcaccatc 186
               ||||||||||||||
Sbjct: 5945968 agatcgtcaccatc 5945955






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 83      gggccctggcggcc 96
               ||||||||||||||
Sbjct: 6007416 gggccctggcggcc 6007429






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 215     tgatcgccttcggc 228
               ||||||||||||||
Sbjct: 6024134 tgatcgccttcggc 6024147






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 186     cctggcgatggcgg 199
               ||||||||||||||
Sbjct: 6060494 cctggcgatggcgg 6060507






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 70      ccgcgctggatctg 83
               ||||||||||||||
Sbjct: 6060570 ccgcgctggatctg 6060583






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 87      cctggcggccctgg 100
               ||||||||||||||
Sbjct: 6076272 cctggcggccctgg 6076259






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 183     catcctggcgatgg 196
               ||||||||||||||
Sbjct: 6235109 catcctggcgatgg 6235122






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 162     cgccctgatcaaga 175
               ||||||||||||||
Sbjct: 6265928 cgccctgatcaaga 6265941






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Minus

                             
Query: 68      tgccgcgctggatc 81
               ||||||||||||||
Sbjct: 6297482 tgccgcgctggatc 6297469






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 218     tcgccttcggcttc 231
               ||||||||||||||
Sbjct: 6301646 tcgccttcggcttc 6301659






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 90      ggcggccctggcga 103
               ||||||||||||||
Sbjct: 6402879 ggcggccctggcga 6402892






 Score = 28.2 bits (14), Expect = 4.5
 Identities = 14/14 (100%)
 Strand = Plus / Plus

                             
Query: 197     cggtggacggcatc 210
               ||||||||||||||
Sbjct: 6520386 cggtggacggcatc 6520399






  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3288
Number of Sequences: 1
Number of extensions: 3288
Number of successful extensions: 146
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 146
length of query: 233
length of database: 6,534,396
effective HSP length: 15
effective length of query: 218
effective length of database: 6,534,381
effective search space: 1424495058
effective search space used: 1424495058
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 14 (28.2 bits)