BLASTN 2.2.26 [Sep-21-2011]


Reference:
Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Database: pa14 
           1 sequences; 6,534,396 total letters



Query= (704 letters)

Distribution of 184 Blast Hits on the Query Sequence




                                                                 Score    E
Sequences producing significant alignments:                      (bits) Value

GCTS_68                                                          1294   0.0   
>GCTS_68 
          Length = 6534396

 Score = 1294 bits (653), Expect = 0.0
 Identities = 656/657 (99%)
 Strand = Plus / Minus

                                                                           
Query: 48      tactacggcgaccagcgcagcgtggtgggcagcgtcagctacaagtggtgagcgacgcgt 107
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6344235 tactacggcgaccagcgcagcgtggtgggcagcgtcagctacaagtggtgagcgacgcgt 6344176

                                                                           
Query: 108     cacaggtgcgcaacggcggataaccgcttcgcggttatccgccctaccgcagaacgtacc 167
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6344175 cacaggtgcgcaacggcggataaccgcttcgcggttatccgccctaccgcagaacgtacc 6344116

                                                                           
Query: 168     ttccgggcaccggatgccctcctcccgcctgtgggagagggccgggatatcggtagccgg 227
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6344115 ttccgggcaccggatgccctcctcccgcctgtgggagagggccgggatatcggtagccgg 6344056

                                                                           
Query: 228     cgcatcggggaggacctgcattccgggcgccggagatcgtcgttcaccccgcgatccgac 287
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6344055 cgcatcggggaggacctgcattccgggcgccggagatcgtcgttcaccccgcgatccgac 6343996

                                                                           
Query: 288     cccacagcgcgctggcgtcgtcgtggatcttgaaacgcgggaaagccagggcctggtcgt 347
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6343995 cccacagcgcgctggcgtcgtcgtggatcttgaaacgcgggaaagccagggcctggtcgt 6343936

                                                                           
Query: 348     cgccctgttcgatctcgcgcaactcgtcgagcatggcgctcactccgacgtcctcgaggc 407
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6343935 cgccctgttcgatctcgcgcaactcgtcgagcatggcgctcactccgacgtcctcgaggc 6343876

                                                                           
Query: 408     gccgcagcaactgttcgtcggtatagcggcggaaaggctcgaccagccggtcgaagccgt 467
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6343875 gccgcagcaactgttcgtcggtatagcggcggaaaggctcgaccagccggtcgaagccgt 6343816

                                                                           
Query: 468     cggtcatcagcacgaaggaacgcaacgcggcgagcggcaaggtctcgcgctgcacctggc 527
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6343815 cggtcatcagcacgaaggaacgcaacgcggcgagcggcaaggtctcgcgctgcacctggc 6343756

                                                                           
Query: 528     cgagccagcggtcgctgatgtccagcgcccagtagccctcgggcttgttcatcagcaggc 587
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6343755 cgagccagcggtcgctgatgtccagcgcccagtagccctcgggcttgttcatcagcaggc 6343696

                                                                           
Query: 588     ggttctgccgcacgcgcgggcggctggccttgaacagttcggcgtgatcccactgcggat 647
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 6343695 ggttctgccgcacgcgcgggcggctggccttgaacagttcggcgtgatcccactgcggat 6343636

                                                                        
Query: 648     gttcctcgcgcatccggcagaaatgcgccagggattgccggtccagttcatacaggg 704
               ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
Sbjct: 6343635 gttcctcgcgcatccggcagaaatgcgccagggattgccggtccagttcgtacaggg 6343579

 Score = 56.0 bits (28), Expect = 6e-08
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                                   
Query: 121     cggcggataaccgcttcgcggttatccgccctaccg 156
               |||||||||||||||  |||||||||||||||||||
Sbjct: 5029481 cggcggataaccgctgggcggttatccgccctaccg 5029446

 Score = 52.0 bits (26), Expect = 1e-06
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                    
Query: 121    cggcggataaccgcttcgcggttatccgccctaccgca 158
              |||||||||||||| | |||||||| ||||||||||||
Sbjct: 253186 cggcggataaccgcgttgcggttattcgccctaccgca 253149

 Score = 50.1 bits (25), Expect = 4e-06
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               ||||||||||||||| |||||||||||||
Sbjct: 3610550 ggcggataaccgcttggcggttatccgcc 3610522

 Score = 50.1 bits (25), Expect = 4e-06
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||||||||||||||||||
Sbjct: 4126920 ggcgaataaccgcttcgcggttatccgcc 4126892

 Score = 50.1 bits (25), Expect = 4e-06
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               ||||||||||||| |||||||||||||||
Sbjct: 5315556 ggcggataaccgcgtcgcggttatccgcc 5315584

 Score = 48.1 bits (24), Expect = 2e-05
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                           
Query: 122     ggcggataaccgcttcgcggttatccgc 149
               |||| |||||||||||||||||||||||
Sbjct: 1580438 ggcgaataaccgcttcgcggttatccgc 1580411

 Score = 48.1 bits (24), Expect = 2e-05
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 119     aacggcggataaccgcttcgcggttatccgccctac 154
               |||||||||||||||| | |||||||| ||||||||
Sbjct: 4285636 aacggcggataaccgcgtagcggttattcgccctac 4285601

 Score = 48.1 bits (24), Expect = 2e-05
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                               
Query: 121     cggcggataaccgcttcgcggttatccgccct 152
               ||||||||||||||  ||||||||||||||||
Sbjct: 5315585 cggcggataaccgcgacgcggttatccgccct 5315554

 Score = 44.1 bits (22), Expect = 2e-04
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 121    cggcggataaccgcttcgcggttatccgccctac 154
              ||||||||||||||   |||||||||||||||||
Sbjct: 823830 cggcggataaccgcactgcggttatccgccctac 823797

 Score = 44.1 bits (22), Expect = 2e-04
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                 
Query: 121     cggcggataaccgcttcgcggttatccgccctac 154
               |||||||||||||| | |||||||| ||||||||
Sbjct: 3256512 cggcggataaccgcgtggcggttattcgccctac 3256479

 Score = 44.1 bits (22), Expect = 2e-04
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 121     cggcggataaccgcttcgcggttatccgccctac 154
               ||||||||||||||   |||||||||||||||||
Sbjct: 3610521 cggcggataaccgccaagcggttatccgccctac 3610554

 Score = 44.1 bits (22), Expect = 2e-04
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                                 
Query: 121     cggcggataaccgcttcgcggttatccgccctac 154
               |||||||||||||| | |||||||| ||||||||
Sbjct: 6315895 cggcggataaccgcgttgcggttatgcgccctac 6315928

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                               
Query: 122    ggcggataaccgcttcgcggttatccgccctac 154
              ||||||||||||||  |||||||| ||||||||
Sbjct: 793456 ggcggataaccgctaggcggttattcgccctac 793424

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| |||||||| |||||||||||||||
Sbjct: 1201638 ggcgcataaccgcatcgcggttatccgcc 1201610

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| |||||||| |||||||||||||||
Sbjct: 1201759 ggcgcataaccgcatcgcggttatccgcc 1201731

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               ||||||||||||||| |||||||||||||
Sbjct: 2051008 ggcggataaccgctt-gcggttatccgcc 2050981

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 4104001 ggcgaataaccgctgcgcggttatccgcc 4103973

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 124     cggataaccgcttcgcggttatccg 148
               ||||||| |||||||||||||||||
Sbjct: 4264318 cggataaacgcttcgcggttatccg 4264294

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                    
Query: 121     cggcggataaccgcttcgcggttatccgccctaccgc 157
               |||||||||| |||  ||||| |||||||||||||||
Sbjct: 4266416 cggcggataatcgcgccgcggctatccgccctaccgc 4266452

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 4285605 ggcgaataaccgctacgcggttatccgcc 4285633

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| |||||||| |||||||||||||||
Sbjct: 4896862 ggcgaataaccgcctcgcggttatccgcc 4896890

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||||||||||||| ||||||||||||||
Sbjct: 5006643 ggcggataaccgct-cgcggttatccgcc 5006616

 Score = 42.1 bits (21), Expect = 0.001
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| |||||||| |||||||||||||||
Sbjct: 5311032 ggcgaataaccgcatcgcggttatccgcc 5311060

 Score = 40.1 bits (20), Expect = 0.004
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                           
Query: 127     ataaccgcttcgcggttatccgccctac 154
               |||||||||| |||||||||||||||||
Sbjct: 3405394 ataaccgctt-gcggttatccgccctac 3405368

 Score = 40.1 bits (20), Expect = 0.004
 Identities = 36/40 (90%), Gaps = 1/40 (2%)
 Strand = Plus / Plus

                                                       
Query: 116     cgcaacggcggataaccgcttcgcggttatccgccctacc 155
               |||||||||||||||||||   |||||||| |||||||||
Sbjct: 3805089 cgcaacggcggataaccgc-aagcggttattcgccctacc 3805127

 Score = 40.1 bits (20), Expect = 0.004
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                   
Query: 121     cggcggataaccgcttcgcggttatccgccctaccg 156
               ||||||||||||||   |||||||| ||||||||||
Sbjct: 4896891 cggcggataaccgcgaggcggttattcgccctaccg 4896856

 Score = 40.1 bits (20), Expect = 0.004
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 127     ataaccgcttcgcggttatccgcc 150
               |||||||| |||||||||||||||
Sbjct: 5310892 ataaccgcatcgcggttatccgcc 5310915

 Score = 38.2 bits (19), Expect = 0.015
 Identities = 32/35 (91%), Gaps = 1/35 (2%)
 Strand = Plus / Minus

                                                  
Query: 121     cggcggataaccgcttcgcggttatccgccctacc 155
               ||||||||||||||   ||||||||||||||||||
Sbjct: 1519469 cggcggataaccgcgg-gcggttatccgccctacc 1519436

 Score = 38.2 bits (19), Expect = 0.015
 Identities = 34/39 (87%)
 Strand = Plus / Plus

                                                      
Query: 116     cgcaacggcggataaccgcttcgcggttatccgccctac 154
               |||| ||||||||||||||   |||||||| ||||||||
Sbjct: 4103967 cgcaccggcggataaccgcgcagcggttattcgccctac 4104005

 Score = 38.2 bits (19), Expect = 0.015
 Identities = 32/35 (91%), Gaps = 1/35 (2%)
 Strand = Plus / Plus

                                                  
Query: 120     acggcggataaccgcttcgcggttatccgccctac 154
               |||||||||||||||  ||||||||| ||||||||
Sbjct: 4989363 acggcggataaccgc-acgcggttattcgccctac 4989396

 Score = 38.2 bits (19), Expect = 0.015
 Identities = 32/35 (91%), Gaps = 1/35 (2%)
 Strand = Plus / Plus

                                                  
Query: 120     acggcggataaccgcttcgcggttatccgccctac 154
               |||||||||||||||  ||||||||| ||||||||
Sbjct: 4989468 acggcggataaccgc-acgcggttattcgccctac 4989501

 Score = 38.2 bits (19), Expect = 0.015
 Identities = 32/35 (91%), Gaps = 1/35 (2%)
 Strand = Plus / Plus

                                                  
Query: 120     acggcggataaccgcttcgcggttatccgccctac 154
               |||||||||||||||  ||||||||| ||||||||
Sbjct: 4989574 acggcggataaccgc-acgcggttattcgccctac 4989607

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 30/34 (88%)
 Strand = Plus / Minus

                                                
Query: 121    cggcggataaccgcttcgcggttatccgccctac 154
              |||||||||| |||   |||||||||||||||||
Sbjct: 261756 cggcggataagcgccaggcggttatccgccctac 261723

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 443    ggctcgaccagccggtcg 460
              ||||||||||||||||||
Sbjct: 822712 ggctcgaccagccggtcg 822695

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 30/34 (88%)
 Strand = Plus / Plus

                                                 
Query: 121     cggcggataaccgcttcgcggttatccgccctac 154
               ||||||||||||||   |||||||| ||||||||
Sbjct: 1201730 cggcggataaccgcgatgcggttatgcgccctac 1201763

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 138     gcggttatccgccctacc 155
               ||||||||||||||||||
Sbjct: 2050996 gcggttatccgccctacc 2051013

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 337     ggcctggtcgtcgccctg 354
               ||||||||||||||||||
Sbjct: 2224183 ggcctggtcgtcgccctg 2224200

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 513     cgcgctgcacctggccga 530
               ||||||||||||||||||
Sbjct: 3146888 cgcgctgcacctggccga 3146905

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 18/18 (100%)
 Strand = Plus / Plus

                                 
Query: 363     cgcgcaactcgtcgagca 380
               ||||||||||||||||||
Sbjct: 3763056 cgcgcaactcgtcgagca 3763073

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 34/38 (89%), Gaps = 1/38 (2%)
 Strand = Plus / Plus

                                                     
Query: 118     caacggcggataaccgcttcgcggttatccgccctacc 155
               |||||||||||||||||   |||||||| |||||||||
Sbjct: 3805221 caacggcggataaccgc-aagcggttattcgccctacc 3805257

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 137     cgcggttatccgccctac 154
               ||||||||||||||||||
Sbjct: 4048675 cgcggttatccgccctac 4048658

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 30/34 (88%)
 Strand = Plus / Plus

                                                 
Query: 119     aacggcggataaccgcttcgcggttatccgccct 152
               ||||||||||||||||   |||||||| ||||||
Sbjct: 4126889 aacggcggataaccgcgaagcggttattcgccct 4126922

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 30/34 (88%)
 Strand = Plus / Minus

                                                 
Query: 121     cggcggataaccgcttcgcggttatccgccctac 154
               ||||||||||||||   |||||||| ||||||||
Sbjct: 5311061 cggcggataaccgcgatgcggttattcgccctac 5311028

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 30/34 (88%)
 Strand = Plus / Plus

                                                 
Query: 121     cggcggataaccgcttcgcggttatccgccctac 154
               ||||||||||||||   |||||||| ||||||||
Sbjct: 6335686 cggcggataaccgcgctgcggttattcgccctac 6335719

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 536     cggtcgctgatgtccagc 553
               ||||||||||||||||||
Sbjct: 6403895 cggtcgctgatgtccagc 6403878

 Score = 36.2 bits (18), Expect = 0.058
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                 
Query: 450     ccagccggtcgaagccgt 467
               ||||||||||||||||||
Sbjct: 6412025 ccagccggtcgaagccgt 6412008

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                               
Query: 672    gcgccagggattgccgg 688
              |||||||||||||||||
Sbjct: 175612 gcgccagggattgccgg 175596

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                           
Query: 122    ggcggataaccgcttcgcggttatccgcc 150
              |||| ||||||||  ||||||||||||||
Sbjct: 253157 ggcgaataaccgcaacgcggttatccgcc 253185

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                           
Query: 122    ggcggataaccgcttcgcggttatccgcc 150
              ||||||||||||| | ||| |||||||||
Sbjct: 261727 ggcggataaccgcctggcgcttatccgcc 261755

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 20/21 (95%)
 Strand = Plus / Minus

                                   
Query: 341    tggtcgtcgccctgttcgatc 361
              ||||||||||||| |||||||
Sbjct: 286811 tggtcgtcgccctcttcgatc 286791

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                           
Query: 122    ggcggataaccgcttcgcggttatccgcc 150
              |||| |||||||| | |||||||||||||
Sbjct: 793428 ggcgaataaccgcctagcggttatccgcc 793456

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                           
Query: 122    ggcggataaccgcttcgcggttatccgcc 150
              |||||||||||||   |||||||||||||
Sbjct: 823801 ggcggataaccgcagtgcggttatccgcc 823829

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 29/33 (87%)
 Strand = Plus / Plus

                                                
Query: 122     ggcggataaccgcttcgcggttatccgccctac 154
               |||||||||||||   |||||||| ||||||||
Sbjct: 1201610 ggcggataaccgcgatgcggttatgcgccctac 1201642

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 1628753 ggcgaataaccgct-cgcggttatccgcc 1628780

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 1807195 ggcgaataaccgct-cgcggttatccgcc 1807222

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 1874811 ggcgaataaccgct-cgcggttatccgcc 1874838

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 1874943 ggcgaataaccgct-cgcggttatccgcc 1874970

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 2015470 ggcgaataaccgct-cgcggttatccgcc 2015497

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 2015585 ggcgaataaccgct-cgcggttatccgcc 2015612

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 2015699 ggcgaataaccgct-cgcggttatccgcc 2015726

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 2015814 ggcgaataaccgct-cgcggttatccgcc 2015841

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 364     gcgcaactcgtcgagca 380
               |||||||||||||||||
Sbjct: 2430003 gcgcaactcgtcgagca 2430019

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||  ||||||||||||||
Sbjct: 3256483 ggcgaataaccgccacgcggttatccgcc 3256511

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 3286900 ggcgaataaccgct-cgcggttatccgcc 3286927

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 333     ccagggcctggtcgtcg 349
               |||||||||||||||||
Sbjct: 3483199 ccagggcctggtcgtcg 3483215

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 29/33 (87%)
 Strand = Plus / Minus

                                                
Query: 122     ggcggataaccgcttcgcggttatccgccctac 154
               |||||||||||||   |||||||| ||||||||
Sbjct: 3833241 ggcggataaccgcgctgcggttatgcgccctac 3833209

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||  ||||||||||||||
Sbjct: 3833213 ggcgcataaccgcagcgcggttatccgcc 3833241

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 27/29 (93%), Gaps = 1/29 (3%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||| ||||||||||||||
Sbjct: 4000652 ggcgaataaccgct-cgcggttatccgcc 4000679

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 17/17 (100%)
 Strand = Plus / Minus

                                
Query: 128     taaccgcttcgcggtta 144
               |||||||||||||||||
Sbjct: 4260424 taaccgcttcgcggtta 4260408

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 29/33 (87%)
 Strand = Plus / Plus

                                                
Query: 122     ggcggataaccgcttcgcggttatccgccctac 154
               ||||||||||||||  |||| ||| ||||||||
Sbjct: 4478127 ggcggataaccgctctgcggctattcgccctac 4478159

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 370     ctcgtcgagcatggcgc 386
               |||||||||||||||||
Sbjct: 4863870 ctcgtcgagcatggcgc 4863886

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 17/17 (100%)
 Strand = Plus / Plus

                                
Query: 138     gcggttatccgccctac 154
               |||||||||||||||||
Sbjct: 5006631 gcggttatccgccctac 5006647

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||||||||||||   |||||||||||||
Sbjct: 5029452 ggcggataaccgcccagcggttatccgcc 5029480

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Minus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||  ||||||||||||||
Sbjct: 6315924 ggcgcataaccgcaacgcggttatccgcc 6315896

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Minus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||| ||||||||  ||||||||||||||
Sbjct: 6335715 ggcgaataaccgcagcgcggttatccgcc 6335687

 Score = 34.2 bits (17), Expect = 0.23
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                            
Query: 122     ggcggataaccgcttcgcggttatccgcc 150
               |||||||||||||   |||||||||||||
Sbjct: 6344133 ggcggataaccgcgaagcggttatccgcc 6344161

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                  
Query: 122    ggcggataaccgcttcgcgg 141
              ||||||||||||| ||||||
Sbjct: 428740 ggcggataaccgcgtcgcgg 428759

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 289     ccacagcgcgctggcg 304
               ||||||||||||||||
Sbjct: 1048656 ccacagcgcgctggcg 1048641

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 119     aacggcggataaccgc 134
               ||||||||||||||||
Sbjct: 1059703 aacggcggataaccgc 1059688

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 644     ggatgttcctcgcgca 659
               ||||||||||||||||
Sbjct: 1128949 ggatgttcctcgcgca 1128934

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 583     caggcggttctgccgc 598
               ||||||||||||||||
Sbjct: 1259973 caggcggttctgccgc 1259988

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 301     ggcgtcgtcgtggatc 316
               ||||||||||||||||
Sbjct: 1513380 ggcgtcgtcgtggatc 1513395

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                                   
Query: 492     acgcggcgagcggcaaggtc 511
               |||||||||||||| |||||
Sbjct: 2040667 acgcggcgagcggcgaggtc 2040648

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 481     gaaggaacgcaacgcg 496
               ||||||||||||||||
Sbjct: 2067538 gaaggaacgcaacgcg 2067553

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 580     cagcaggcggttctgc 595
               ||||||||||||||||
Sbjct: 2311898 cagcaggcggttctgc 2311913

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 334     cagggcctggtcgtcg 349
               ||||||||||||||||
Sbjct: 2321306 cagggcctggtcgtcg 2321291

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 361     ctcgcgcaactcgtcg 376
               ||||||||||||||||
Sbjct: 2627214 ctcgcgcaactcgtcg 2627199

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 362     tcgcgcaactcgtcga 377
               ||||||||||||||||
Sbjct: 2700841 tcgcgcaactcgtcga 2700856

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 442     aggctcgaccagccgg 457
               ||||||||||||||||
Sbjct: 3045459 aggctcgaccagccgg 3045444

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 463     gccgtcggtcatcagc 478
               ||||||||||||||||
Sbjct: 3101199 gccgtcggtcatcagc 3101214

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 22/24 (91%)
 Strand = Plus / Minus

                                       
Query: 121     cggcggataaccgcttcgcggtta 144
               |||||||||||||| | |||||||
Sbjct: 3206434 cggcggataaccgccttgcggtta 3206411

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                                   
Query: 361     ctcgcgcaactcgtcgagca 380
               |||||||| |||||||||||
Sbjct: 4079356 ctcgcgcacctcgtcgagca 4079337

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 333     ccagggcctggtcgtc 348
               ||||||||||||||||
Sbjct: 4116913 ccagggcctggtcgtc 4116898

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 516     gctgcacctggccgag 531
               ||||||||||||||||
Sbjct: 4230146 gctgcacctggccgag 4230131

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Plus

                               
Query: 363     cgcgcaactcgtcgag 378
               ||||||||||||||||
Sbjct: 4770227 cgcgcaactcgtcgag 4770242

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                                   
Query: 402     cgaggcgccgcagcaactgt 421
               ||||||| ||||||||||||
Sbjct: 4886981 cgaggcgacgcagcaactgt 4886962

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 23/24 (95%), Gaps = 1/24 (4%)
 Strand = Plus / Plus

                                       
Query: 127     ataaccgcttcgcggttatccgcc 150
               ||||||||| ||||||||||||||
Sbjct: 4896969 ataaccgct-cgcggttatccgcc 4896991

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 517     ctgcacctggccgagc 532
               ||||||||||||||||
Sbjct: 4911807 ctgcacctggccgagc 4911792

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 16/16 (100%)
 Strand = Plus / Minus

                               
Query: 516     gctgcacctggccgag 531
               ||||||||||||||||
Sbjct: 4974517 gctgcacctggccgag 4974502

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 19/20 (95%)
 Strand = Plus / Plus

                                   
Query: 489     gcaacgcggcgagcggcaag 508
               |||| |||||||||||||||
Sbjct: 5919525 gcaaggcggcgagcggcaag 5919544

 Score = 32.2 bits (16), Expect = 0.90
 Identities = 19/20 (95%)
 Strand = Plus / Minus

                                   
Query: 138     gcggttatccgccctaccgc 157
               |||||||| |||||||||||
Sbjct: 6382318 gcggttattcgccctaccgc 6382299

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                            
Query: 463   gccgtcggtcatcag 477
             |||||||||||||||
Sbjct: 12995 gccgtcggtcatcag 13009

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 370    ctcgtcgagcatggc 384
              |||||||||||||||
Sbjct: 104818 ctcgtcgagcatggc 104832

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 654    cgcgcatccggcaga 668
              |||||||||||||||
Sbjct: 144478 cgcgcatccggcaga 144464

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 181    atgccctcctcccgc 195
              |||||||||||||||
Sbjct: 243336 atgccctcctcccgc 243322

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 332    gccagggcctggtcg 346
              |||||||||||||||
Sbjct: 334887 gccagggcctggtcg 334901

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 137    cgcggttatccgccc 151
              |||||||||||||||
Sbjct: 428753 cgcggttatccgccc 428739

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 414    gcaactgttcgtcgg 428
              |||||||||||||||
Sbjct: 436387 gcaactgttcgtcgg 436373

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 323    cgcgggaaagccagg 337
              |||||||||||||||
Sbjct: 510323 cgcgggaaagccagg 510337

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                 
Query: 405    ggcgccgcagcaactgttc 423
              |||| ||||||||||||||
Sbjct: 744950 ggcggcgcagcaactgttc 744932

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 339    cctggtcgtcgccct 353
              |||||||||||||||
Sbjct: 762878 cctggtcgtcgccct 762892

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                             
Query: 332    gccagggcctggtcg 346
              |||||||||||||||
Sbjct: 870445 gccagggcctggtcg 870459

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 370    ctcgtcgagcatggc 384
              |||||||||||||||
Sbjct: 894753 ctcgtcgagcatggc 894739

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                             
Query: 359    atctcgcgcaactcg 373
              |||||||||||||||
Sbjct: 961877 atctcgcgcaactcg 961863

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 512     tcgcgctgcacctggccga 530
               ||||| |||||||||||||
Sbjct: 1194967 tcgcgatgcacctggccga 1194985

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 340     ctggtcgtcgccctg 354
               |||||||||||||||
Sbjct: 1264558 ctggtcgtcgccctg 1264572

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 414     gcaactgttcgtcgg 428
               |||||||||||||||
Sbjct: 1498120 gcaactgttcgtcgg 1498134

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 60      cagcgcagcgtggtg 74
               |||||||||||||||
Sbjct: 1544550 cagcgcagcgtggtg 1544536

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 640     ctgcggatgttcctcgcgc 658
               |||||| ||||||||||||
Sbjct: 1576492 ctgcggctgttcctcgcgc 1576510

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 522     cctggccgagccagc 536
               |||||||||||||||
Sbjct: 1603759 cctggccgagccagc 1603745

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 648     gttcctcgcgcatcc 662
               |||||||||||||||
Sbjct: 1730138 gttcctcgcgcatcc 1730152

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 120     acggcggataaccgc 134
               |||||||||||||||
Sbjct: 1874840 acggcggataaccgc 1874826

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 120     acggcggataaccgc 134
               |||||||||||||||
Sbjct: 1874972 acggcggataaccgc 1874958

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 296     gcgctggcgtcgtcg 310
               |||||||||||||||
Sbjct: 1928765 gcgctggcgtcgtcg 1928751

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 120     acggcggataaccgc 134
               |||||||||||||||
Sbjct: 2073947 acggcggataaccgc 2073961

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 447     cgaccagccggtcga 461
               |||||||||||||||
Sbjct: 2081391 cgaccagccggtcga 2081377

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 617     ttgaacagttcggcg 631
               |||||||||||||||
Sbjct: 2101056 ttgaacagttcggcg 2101070

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 141     gttatccgccctacc 155
               |||||||||||||||
Sbjct: 2126406 gttatccgccctacc 2126420

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 497     gcgagcggcaaggtc 511
               |||||||||||||||
Sbjct: 2145594 gcgagcggcaaggtc 2145608

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 610     gctggccttgaacag 624
               |||||||||||||||
Sbjct: 2168229 gctggccttgaacag 2168243

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 53      cggcgaccagcgcag 67
               |||||||||||||||
Sbjct: 2200126 cggcgaccagcgcag 2200140

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 528     cgagccagcggtcgc 542
               |||||||||||||||
Sbjct: 2439331 cgagccagcggtcgc 2439345

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 298     gctggcgtcgtcgtg 312
               |||||||||||||||
Sbjct: 2491700 gctggcgtcgtcgtg 2491686

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 251     cgggcgccggagatcgtcg 269
               ||||||| |||||||||||
Sbjct: 2641480 cgggcgctggagatcgtcg 2641462

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 601     gcgcgggcggctggccttg 619
               |||||| ||||||||||||
Sbjct: 2648901 gcgcggccggctggccttg 2648883

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 517     ctgcacctggccgag 531
               |||||||||||||||
Sbjct: 2672702 ctgcacctggccgag 2672716

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 518     tgcacctggccgagc 532
               |||||||||||||||
Sbjct: 3036871 tgcacctggccgagc 3036885

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 363     cgcgcaactcgtcga 377
               |||||||||||||||
Sbjct: 3156913 cgcgcaactcgtcga 3156927

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 447     cgaccagccggtcga 461
               |||||||||||||||
Sbjct: 3189718 cgaccagccggtcga 3189732

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 296     gcgctggcgtcgtcg 310
               |||||||||||||||
Sbjct: 3219448 gcgctggcgtcgtcg 3219462

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 456     ggtcgaagccgtcgg 470
               |||||||||||||||
Sbjct: 3235987 ggtcgaagccgtcgg 3235973

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 136     tcgcggttatccgcc 150
               |||||||||||||||
Sbjct: 3271377 tcgcggttatccgcc 3271391

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 138     gcggttatccgccct 152
               |||||||||||||||
Sbjct: 3278169 gcggttatccgccct 3278155

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 410     cgcagcaactgttcg 424
               |||||||||||||||
Sbjct: 3510132 cgcagcaactgttcg 3510118

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 372     cgtcgagcatggcgc 386
               |||||||||||||||
Sbjct: 3562515 cgtcgagcatggcgc 3562501

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 578     atcagcaggcggttc 592
               |||||||||||||||
Sbjct: 3609340 atcagcaggcggttc 3609326

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 24/27 (88%)
 Strand = Plus / Plus

                                          
Query: 123     gcggataaccgcttcgcggttatccgc 149
               |||||||||||  |||||| |||||||
Sbjct: 3682146 gcggataaccgtatcgcggctatccgc 3682172

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 379     catggcgctcactcc 393
               |||||||||||||||
Sbjct: 3764985 catggcgctcactcc 3764999

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 580     cagcaggcggttctg 594
               |||||||||||||||
Sbjct: 3777437 cagcaggcggttctg 3777423

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 30/35 (85%)
 Strand = Plus / Plus

                                                  
Query: 121     cggcggataaccgcttcgcggttatccgccctacc 155
               |||||||||||  || ||  |||||||||||||||
Sbjct: 3833137 cggcggataacgcctgcgtcgttatccgccctacc 3833171

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 136     tcgcggttatccgcc 150
               |||||||||||||||
Sbjct: 3902555 tcgcggttatccgcc 3902541

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 409     ccgcagcaactgttcgtcg 427
               ||||||| |||||||||||
Sbjct: 3918754 ccgcagcgactgttcgtcg 3918772

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 345     cgtcgccctgttcga 359
               |||||||||||||||
Sbjct: 4003376 cgtcgccctgttcga 4003362

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 456     ggtcgaagccgtcgg 470
               |||||||||||||||
Sbjct: 4006911 ggtcgaagccgtcgg 4006897

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 371     tcgtcgagcatggcg 385
               |||||||||||||||
Sbjct: 4121816 tcgtcgagcatggcg 4121802

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 523     ctggccgagccagcggtcg 541
               |||| ||||||||||||||
Sbjct: 4137930 ctggtcgagccagcggtcg 4137912

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 512     tcgcgctgcacctggccga 530
               |||||| ||||||||||||
Sbjct: 4234478 tcgcgcggcacctggccga 4234496

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 332     gccagggcctggtcg 346
               |||||||||||||||
Sbjct: 4328506 gccagggcctggtcg 4328492

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 340     ctggtcgtcgccctg 354
               |||||||||||||||
Sbjct: 4452422 ctggtcgtcgccctg 4452436

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 444     gctcgaccagccggt 458
               |||||||||||||||
Sbjct: 4608493 gctcgaccagccggt 4608479

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 335     agggcctggtcgtcgccct 353
               ||||||| |||||||||||
Sbjct: 4673074 agggccttgtcgtcgccct 4673056

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 469     ggtcatcagcacgaa 483
               |||||||||||||||
Sbjct: 4739476 ggtcatcagcacgaa 4739462

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Minus

                                  
Query: 333     ccagggcctggtcgtcgcc 351
               |||||||||||| ||||||
Sbjct: 4816963 ccagggcctggtagtcgcc 4816945

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 200     gggagagggccggga 214
               |||||||||||||||
Sbjct: 4844707 gggagagggccggga 4844693

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 516     gctgcacctggccga 530
               |||||||||||||||
Sbjct: 4854465 gctgcacctggccga 4854479

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 21/23 (91%)
 Strand = Plus / Minus

                                      
Query: 328     gaaagccagggcctggtcgtcgc 350
               |||| ||||| ||||||||||||
Sbjct: 4860047 gaaacccaggccctggtcgtcgc 4860025

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 136     tcgcggttatccgcc 150
               |||||||||||||||
Sbjct: 4995794 tcgcggttatccgcc 4995808

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 333     ccagggcctggtcgt 347
               |||||||||||||||
Sbjct: 5189078 ccagggcctggtcgt 5189064

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 332     gccagggcctggtcg 346
               |||||||||||||||
Sbjct: 5191992 gccagggcctggtcg 5191978

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 369     actcgtcgagcatgg 383
               |||||||||||||||
Sbjct: 5206382 actcgtcgagcatgg 5206368

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 352     ctgttcgatctcgcg 366
               |||||||||||||||
Sbjct: 5394376 ctgttcgatctcgcg 5394390

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 588     ggttctgccgcacgc 602
               |||||||||||||||
Sbjct: 5424631 ggttctgccgcacgc 5424645

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 343     gtcgtcgccctgttc 357
               |||||||||||||||
Sbjct: 5457063 gtcgtcgccctgttc 5457077

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 393     cgacgtcctcgaggc 407
               |||||||||||||||
Sbjct: 5537662 cgacgtcctcgaggc 5537676

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 291     acagcgcgctggcgt 305
               |||||||||||||||
Sbjct: 5664140 acagcgcgctggcgt 5664126

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 601     gcgcgggcggctggc 615
               |||||||||||||||
Sbjct: 5664300 gcgcgggcggctggc 5664314

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 523     ctggccgagccagcg 537
               |||||||||||||||
Sbjct: 5700519 ctggccgagccagcg 5700533

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 18/19 (94%)
 Strand = Plus / Plus

                                  
Query: 51      tacggcgaccagcgcagcg 69
               |||| ||||||||||||||
Sbjct: 5700695 tacgccgaccagcgcagcg 5700713

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 120     acggcggataaccgc 134
               |||||||||||||||
Sbjct: 5761609 acggcggataaccgc 5761623

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 508     ggtctcgcgctgcac 522
               |||||||||||||||
Sbjct: 5781187 ggtctcgcgctgcac 5781201

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 509     gtctcgcgctgcacc 523
               |||||||||||||||
Sbjct: 5909739 gtctcgcgctgcacc 5909753

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Plus

                              
Query: 49      actacggcgaccagc 63
               |||||||||||||||
Sbjct: 6020462 actacggcgaccagc 6020476

 Score = 30.2 bits (15), Expect = 3.6
 Identities = 15/15 (100%)
 Strand = Plus / Minus

                              
Query: 332     gccagggcctggtcg 346
               |||||||||||||||
Sbjct: 6121776 gccagggcctggtcg 6121762
  Database: pa14
    Posted date:  Jan 15, 2004  3:01 PM
  Number of letters in database: 6,534,396
  Number of sequences in database:  1
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 9409
Number of Sequences: 1
Number of extensions: 9409
Number of successful extensions: 184
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 2
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 184
length of query: 704
length of database: 6,534,396
effective HSP length: 16
effective length of query: 688
effective length of database: 6,534,380
effective search space: 4495653440
effective search space used: 4495653440
T: 0
A: 0
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 15 (30.2 bits)